e.g. 1:1246..9423
SNP Detail For snp_cf0041000482921    [See in GBrowse]
1.General Information
SNP ID: snp_cf0041000482921
Organism: Canis familiaris
Individual: KM6
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: GAGCCCGAGTGGATCGGGGACGGAGAGAGT
3'flank: CGAGCCCCACCGGTGAGGCTGATAGGCAGG
3.Reference Map information
Chrom Position Reference KM6
Chr12 397101 T A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000030478 61 + T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000000632 61 TCG => ACG ENSCAFP00000000577 21 S => T
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0039000402313 KM4 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0016000509410 DQ8 W GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0069000527776 YJ10 W GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0020000500293 FAMBTIM00001 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0036000396744 KM1 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0006000592726 CRW A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0067000502886 TM8 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0048000482191 LJ3 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0057000631173 LUPWRUS00002 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0051000506118 LJ6 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0049000520879 LJ4 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0035000478026 KM10 W GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0037000412100 KM2 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0078000522196 YJ9 W GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0002000332787 CID1 W GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-08-02 2014-08-02
snp_cf0072000524710 YJ3 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0076000524103 YJ7 W GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0063000506920 TM4 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0005000627117 CHW A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0040000440753 KM5 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0024000419480 GS10 W GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0010000505000 DQ2 W GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0008000502003 DQ10 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0001000250936 solidGW1 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-08-01 2014-08-01
snp_cf0066000515778 TM7 W GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0026000389808 GS2 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0065000482899 TM6 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0070000535030 YJ1 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0058000642099 LUPWRUS00003 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0032000383065 GS8 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0004000420885 Basenji A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0056000652237 LUPWRUS00001 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0012000504240 DQ4 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0014000499239 DQ6 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0064000514811 TM5 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0007000423854 Dingo W GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0025000371765 GS1 W GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0047000477443 LJ2 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0062000516885 TM3 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0031000390110 GS7 W GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0021000482447 FAMICHN00001 W GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0013000501702 DQ5 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0011000511572 DQ3 W GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0073000514527 YJ4 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0027000386693 GS3 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0059000515880 TM10 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0055000647154 LUPWCHN00001 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0074000516296 YJ5 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0075000528316 YJ6 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0068000494544 TM9 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0015000506818 DQ7 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0045000438779 LJ10 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0052000492972 LJ7 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0060000521668 TM1 W GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0046000454612 LJ1 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0017000523243 DQ9 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0042000497318 KM7 W GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0038000404752 KM3 W GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0071000519590 YJ2 W GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0009000505852 DQ1 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0019000386307 FAMBGSD00001 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0061000515121 TM2 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0023000476390 FAMICHN00003 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0053000492988 LJ8 A GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
snp_cf0033000406131 GS9 W GAGCCCGAGTGGATCGGGGACGGAGAGAGT CGAGCCCCACCGGTGAGGCTGATAGGCAGG 2014-07-19 2014-07-19
6.Fasta Information
GACCTAGGCA GCAGCCGCCG GAGCCCGAGT GGATCGGGGA CGGAGAGAGT
A
CGAGCCCCAC CGGTGAGGCT GATAGGCAGG GAGCCAACGG GAGAGAAAAG