e.g. 1:1246..9423
SNP Detail For snp_cf0041000482922    [See in GBrowse]
1.General Information
SNP ID: snp_cf0041000482922
Organism: Canis familiaris
Individual: KM6
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: ATCGGGGACGGAGAGAGTTCGAGCCCCACC
3'flank: GTGAGGCTGATAGGCAGGGAGCCAACGGGA
3.Reference Map information
Chrom Position Reference KM6
Chr12 397113 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000030478 73 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000000632 73 GAC => AAC ENSCAFP00000000577 25 D => N
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0071000519591 YJ2 R ATCGGGGACGGAGAGAGTTCGAGCCCCACC GTGAGGCTGATAGGCAGGGAGCCAACGGGA 2014-07-19 2014-07-19
snp_cf0030000395441 GS6 R ATCGGGGACGGAGAGAGTTCGAGCCCCACC GTGAGGCTGATAGGCAGGGAGCCAACGGGA 2014-07-19 2014-07-19
snp_cf0044000444695 KM9 A ATCGGGGACGGAGAGAGTTCGAGCCCCACC GTGAGGCTGATAGGCAGGGAGCCAACGGGA 2014-07-19 2014-07-19
snp_cf0029000337536 GS5 R ATCGGGGACGGAGAGAGTTCGAGCCCCACC GTGAGGCTGATAGGCAGGGAGCCAACGGGA 2014-07-19 2014-07-19
snp_cf0038000404753 KM3 R ATCGGGGACGGAGAGAGTTCGAGCCCCACC GTGAGGCTGATAGGCAGGGAGCCAACGGGA 2014-07-19 2014-07-19
6.Fasta Information
AGCCGCCGGA GCCCGAGTGG ATCGGGGACG GAGAGAGTTC GAGCCCCACC
R
GTGAGGCTGA TAGGCAGGGA GCCAACGGGA GAGAAAAGGG GAGAAGAGAG