e.g. 1:1246..9423
SNP Detail For snp_cf0041001174753    [See in GBrowse]
1.General Information
SNP ID: snp_cf0041001174753
Organism: Canis familiaris
Individual: KM6
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: GGACGGGCCGGGCACGCCCCGGGCGCTGGG
3'flank: GAGGCCGGGCAGCTCGGGGACACCGCGGGG
3.Reference Map information
Chrom Position Reference KM6
Chr17 22516 G A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0021001114730 FAMICHN00001 A GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0065001144562 TM6 A GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0038000894702 KM3 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0016001168275 DQ8 A GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0026000907492 GS2 A GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0035001135459 KM10 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0052001144431 LJ7 A GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0063001151038 TM4 A GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0015001167268 DQ7 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0037000994698 KM2 A GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0074001191753 YJ5 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0078001197782 YJ9 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0069001209223 YJ10 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0043000978348 KM8 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0014001157245 DQ6 A GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0060001166147 TM1 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0012001175124 DQ4 A GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0030000933103 GS6 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0077001187244 YJ8 A GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0013001127336 DQ5 A GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0071001197001 YJ2 A GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0072001204577 YJ3 A GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0073001161499 YJ4 A GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0039000943324 KM4 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0070001240229 YJ1 A GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0061001187800 TM2 A GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0040001033120 KM5 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0075001203344 YJ6 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0068001120742 TM9 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0025000910719 GS1 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0011001189834 DQ3 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0044001041736 KM9 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0059001180821 TM10 A GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0010001157066 DQ2 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0042001217023 KM7 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0032000906591 GS8 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0031000919654 GS7 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0067001141824 TM8 A GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0008001168280 DQ10 A GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0076001209438 YJ7 A GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0017001183385 DQ9 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0024000951468 GS10 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0064001181487 TM5 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0036000922354 KM1 A GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0027000912916 GS3 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
snp_cf0009001175415 DQ1 R GGACGGGCCGGGCACGCCCCGGGCGCTGGG GAGGCCGGGCAGCTCGGGGACACCGCGGGG 2014-07-19 2014-07-19
6.Fasta Information
GTCCCGAGGG CGGGGCGGGA GGACGGGCCG GGCACGCCCC GGGCGCTGGG
A
GAGGCCGGGC AGCTCGGGGA CACCGCGGGG GCCGGGGCGG CCGACGGGGC