e.g. 1:1246..9423
SNP Detail For snp_cf0041001174754    [See in GBrowse]
1.General Information
SNP ID: snp_cf0041001174754
Organism: Canis familiaris
Individual: KM6
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: ACGGGCCGCGGGACGGGCGCGCCACGGGCT
3'flank: GGGGCCCAGGTGCCTCCGCCCGCACAGCTC
3.Reference Map information
Chrom Position Reference KM6
Chr17 23348 G C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0059001180822 TM10 S ACGGGCCGCGGGACGGGCGCGCCACGGGCT GGGGCCCAGGTGCCTCCGCCCGCACAGCTC 2014-07-19 2014-07-19
snp_cf0020001159363 FAMBTIM00001 C ACGGGCCGCGGGACGGGCGCGCCACGGGCT GGGGCCCAGGTGCCTCCGCCCGCACAGCTC 2014-07-19 2014-07-19
snp_cf0078001197783 YJ9 S ACGGGCCGCGGGACGGGCGCGCCACGGGCT GGGGCCCAGGTGCCTCCGCCCGCACAGCTC 2014-07-19 2014-07-19
snp_cf0026000907493 GS2 C ACGGGCCGCGGGACGGGCGCGCCACGGGCT GGGGCCCAGGTGCCTCCGCCCGCACAGCTC 2014-07-19 2014-07-19
snp_cf0033000912905 GS9 C ACGGGCCGCGGGACGGGCGCGCCACGGGCT GGGGCCCAGGTGCCTCCGCCCGCACAGCTC 2014-07-19 2014-07-19
6.Fasta Information
GGGAGGCCGG CCGGAGGCAG ACGGGCCGCG GGACGGGCGC GCCACGGGCT
C
GGGGCCCAGG TGCCTCCGCC CGCACAGCTC GAGGCGGAGG CCGCGTGCTC