e.g. 1:1246..9423
SNP Detail For snp_cf0041001174760    [See in GBrowse]
1.General Information
SNP ID: snp_cf0041001174760
Organism: Canis familiaris
Individual: KM6
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: TCTTCCAGAAACTCCACCAGGAGACCCGGC
3'flank: CGCAGACAAATGGATAAAAATGCTCAAGCG
3.Reference Map information
Chrom Position Reference KM6
Chr17 35295 A R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0070001240234 YJ1 G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0056001486841 LUPWRUS00001 G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0073001161502 YJ4 R TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0042001217029 KM7 R TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0049001182949 LJ4 G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0001000496838 solidGW1 R TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-08-01 2014-08-01
snp_cf0052001144436 LJ7 R TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0021001114734 FAMICHN00001 R TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0072001204581 YJ3 G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0043000978352 KM8 R TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0053001137519 LJ8 G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0014001157250 DQ6 R TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0065001144567 TM6 G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0057001408060 LUPWRUS00002 G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0038000894706 KM3 R TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0020001159367 FAMBTIM00001 R TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0074001191755 YJ5 G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0044001041740 KM9 R TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0015001167271 DQ7 R TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0004000976022 Basenji G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0078001197787 YJ9 G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0064001181491 TM5 R TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0016001168281 DQ8 G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0071001197004 YJ2 R TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0005001436886 CHW G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0018000981227 FAMBBEM00001 R TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0061001187807 TM2 G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0062001176868 TM3 G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0055001471105 LUPWCHN00001 R TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0058001472230 LUPWRUS00003 R TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0063001151043 TM4 R TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0068001120747 TM9 R TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0076001209444 YJ7 G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0010001157070 DQ2 R TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0011001189838 DQ3 G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0059001180827 TM10 G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0051001175793 LJ6 R TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0067001141829 TM8 G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0075001203346 YJ6 R TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0060001166150 TM1 G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0007001000750 Dingo G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0008001168281 DQ10 R TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0009001175419 DQ1 G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0034001382597 ISW G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0069001209230 YJ10 G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0012001175130 DQ4 G TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
snp_cf0066001198860 TM7 R TCTTCCAGAAACTCCACCAGGAGACCCGGC CGCAGACAAATGGATAAAAATGCTCAAGCG 2014-07-19 2014-07-19
6.Fasta Information
CCTGTGGCCC CCGCTTGTCC TCTTCCAGAA ACTCCACCAG GAGACCCGGC
R
CGCAGACAAA TGGATAAAAA TGCTCAAGCG ATGGGACCAC TACCTCCCCA