e.g. 1:1246..9423
SNP Detail For snp_cf0041001174761    [See in GBrowse]
1.General Information
SNP ID: snp_cf0041001174761
Organism: Canis familiaris
Individual: KM6
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs9100257  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: M
5'flank: TCCACAGACACCCTGGAGCCGAAGCTGGAA
3'flank: CTTCTAGATGCCTCGTGCTCCCTGGGCTCC
3.Reference Map information
Chrom Position Reference KM6
Chr17 35606 C M
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0073001161503 YJ4 M TCCACAGACACCCTGGAGCCGAAGCTGGAA CTTCTAGATGCCTCGTGCTCCCTGGGCTCC 2014-07-19 2014-07-19
snp_cf0001000496841 solidGW1 M TCCACAGACACCCTGGAGCCGAAGCTGGAA CTTCTAGATGCCTCGTGCTCCCTGGGCTCC 2014-08-01 2014-08-01
snp_cf0058001472231 LUPWRUS00003 A TCCACAGACACCCTGGAGCCGAAGCTGGAA CTTCTAGATGCCTCGTGCTCCCTGGGCTCC 2014-07-19 2014-07-19
snp_cf0042001217030 KM7 M TCCACAGACACCCTGGAGCCGAAGCTGGAA CTTCTAGATGCCTCGTGCTCCCTGGGCTCC 2014-07-19 2014-07-19
snp_cf0023001085798 FAMICHN00003 M TCCACAGACACCCTGGAGCCGAAGCTGGAA CTTCTAGATGCCTCGTGCTCCCTGGGCTCC 2014-07-19 2014-07-19
snp_cf0063001151044 TM4 M TCCACAGACACCCTGGAGCCGAAGCTGGAA CTTCTAGATGCCTCGTGCTCCCTGGGCTCC 2014-07-19 2014-07-19
6.Fasta Information
CTCCAGGGAG ACCCAGCCTC TCCACAGACA CCCTGGAGCC GAAGCTGGAA
M
CTTCTAGATG CCTCGTGCTC CCTGGGCTCC AAGGGGCCGC CCCGGGCCCC