e.g. 1:1246..9423
SNP Detail For snp_cf0041003697804    [See in GBrowse]
1.General Information
SNP ID: snp_cf0041003697804
Organism: Canis familiaris
Individual: KM6
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: CATGGAATATCGATCTCCTTTGCGCTTCAT
3'flank: TTCTTCCTTTCCTGATCAGAAACAGCTGCC
3.Reference Map information
Chrom Position Reference KM6
Chr4 2476857 C T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000010034 622841 - C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000044598 10335 AAG => AAA ENSCAFP00000040266 3445 K => K
- ENSCAFT00000015962 10308 AAG => AAA ENSCAFP00000014764 3436 K => K
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0018003068336 FAMBBEM00001 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0048003517174 LJ3 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0067003642100 TM8 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0070003915228 YJ1 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0013003622151 DQ5 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0053003608653 LJ8 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0008003743902 DQ10 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0004003088432 Basenji T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0047003592171 LJ2 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0039003107813 KM4 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0045003369677 LJ10 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0015003683003 DQ7 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0078003776226 YJ9 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0063003638589 TM4 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0069003813478 YJ10 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0019002874165 FAMBGSD00001 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0011003752099 DQ3 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0035003582508 KM10 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0002002454068 CID1 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-08-02 2014-08-02
snp_cf0030002881317 GS6 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0021003540164 FAMICHN00001 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0022003293989 FAMICHN00002 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0060003609559 TM1 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0016003697238 DQ8 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0046003442460 LJ1 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0028002800611 GS4 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0029002729401 GS5 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0072003792064 YJ3 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0044003257072 KM9 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0076003805978 YJ7 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0032002858213 GS8 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0052003629572 LJ7 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0009003682787 DQ1 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0043003106288 KM8 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0042003853982 KM7 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0077003765624 YJ8 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0010003708307 DQ2 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0037003083751 KM2 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0031002932257 GS7 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0065003678061 TM6 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0038002975161 KM3 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0049003715884 LJ4 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0033002911198 GS9 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0073003716316 YJ4 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0051003691715 LJ6 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0012003692578 DQ4 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0062003696470 TM3 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0061003747758 TM2 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0074003721476 YJ5 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0025002881613 GS1 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0024002913516 GS10 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0040003207923 KM5 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0075003784090 YJ6 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0026002899707 GS2 Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0036002932342 KM1 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0007003135213 Dingo Y CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0027002896680 GS3 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
snp_cf0050003434339 LJ5 T CATGGAATATCGATCTCCTTTGCGCTTCAT TTCTTCCTTTCCTGATCAGAAACAGCTGCC 2014-07-19 2014-07-19
6.Fasta Information
GCCACAATAA GAGAAGTCTG CATGGAATAT CGATCTCCTT TGCGCTTCAT
T
TTCTTCCTTT CCTGATCAGA AACAGCTGCC TACGGAATAA AGCTACGTGT