e.g. 1:1246..9423
SNP Detail For snp_cf0041003698252    [See in GBrowse]
1.General Information
SNP ID: snp_cf0041003698252
Organism: Canis familiaris
Individual: KM6
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs24039493  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: AATTGTTTCAATAAAAGGTCTCATTTCAGC
3'flank: GCACCCAGAGCACAGTTTAATCCGATACTG
3.Reference Map information
Chrom Position Reference KM6
Chr4 3297789 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000010464 29926 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000016858 792 GCA => GCG ENSCAFP00000015601 264 A => A
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0055004563010 LUPWCHN00001 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0023003526796 FAMICHN00003 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0007003136043 Dingo C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0026002900584 GS2 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0002002454613 CID1 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-08-02 2014-08-02
snp_cf0014003663790 DQ6 Y AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0066003787492 TM7 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0061003748656 TM2 Y AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0078003777080 YJ9 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0060003610225 TM1 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0043003106705 KM8 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0042003854453 KM7 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0057004368283 LUPWRUS00002 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0008003744764 DQ10 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0058004550181 LUPWRUS00003 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0049003716593 LJ4 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0072003793002 YJ3 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0035003583069 KM10 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0022003294817 FAMICHN00002 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0075003784939 YJ6 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0073003717027 YJ4 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0004003088838 Basenji C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0050003434966 LJ5 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0077003766743 YJ8 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0025002882489 GS1 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0051003692428 LJ6 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0003002123831 dbSNP139 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0052003630316 LJ7 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0068003655620 TM9 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0059003697368 TM10 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0064003726122 TM5 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0046003443554 LJ1 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0069003814152 YJ10 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0019002874559 FAMBGSD00001 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0006004250806 CRW C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0076003806706 YJ7 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0020003662228 FAMBTIM00001 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0040003208794 KM5 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0021003540847 FAMICHN00001 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0005004408576 CHW C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0027002897078 GS3 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0037003084150 KM2 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0056004585754 LUPWRUS00001 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0062003697175 TM3 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0009003683673 DQ1 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0032002858612 GS8 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0016003698145 DQ8 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0013003623024 DQ5 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0074003722377 YJ5 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0053003609446 LJ8 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0031002932655 GS7 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0033002911990 GS9 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0047003593284 LJ2 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0038002975560 KM3 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0045003370563 LJ10 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0029002730082 GS5 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0065003678647 TM6 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0063003639035 TM4 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0044003257961 KM9 Y AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0067003642978 TM8 Y AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0012003693465 DQ4 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0018003068924 FAMBBEM00001 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0024002913916 GS10 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0039003108689 KM4 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0054003383750 LJ9 Y AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0011003752959 DQ3 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0010003709015 DQ2 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0028002801405 GS4 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0048003517812 LJ3 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0034004269104 ISW C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0017003745447 DQ9 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0015003683855 DQ7 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0071003782039 YJ2 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0030002882107 GS6 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0070003916095 YJ1 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
snp_cf0036002932741 KM1 C AATTGTTTCAATAAAAGGTCTCATTTCAGC GCACCCAGAGCACAGTTTAATCCGATACTG 2014-07-19 2014-07-19
6.Fasta Information
TAGGCTGTTG TACATTTTCC AATTGTTTCA ATAAAAGGTC TCATTTCAGC
C
GCACCCAGAG CACAGTTTAA TCCGATACTG TAAAAACCAA AAGAAGAGAT