e.g. 1:1246..9423
SNP Detail For snp_cf0041003698335    [See in GBrowse]
1.General Information
SNP ID: snp_cf0041003698335
Organism: Canis familiaris
Individual: KM6
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: ATGCGTCGAAGCCTTCTGCCTAAACTTCTC
3'flank: GCCAGGTGTTCCACACGCTCCAGCCTCCGA
3.Reference Map information
Chrom Position Reference KM6
Chr4 3366046 C T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000010822 49079 - C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000017321 1209 GCG => GCA ENSCAFP00000016032 403 A => A
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0062003697275 TM3 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0036002932822 KM1 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0059003697476 TM10 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0021003540950 FAMICHN00001 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0042003854536 KM7 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0043003106788 KM8 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0067003643079 TM8 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0039003108796 KM4 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0074003722480 YJ5 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0047003593384 LJ2 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0030002882193 GS6 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0028002801491 GS4 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0063003639132 TM4 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0065003678746 TM6 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0023003526889 FAMICHN00003 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0019002874641 FAMBGSD00001 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0075003785039 YJ6 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0071003782136 YJ2 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0010003709116 DQ2 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0012003693563 DQ4 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0008003744875 DQ10 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0053003609546 LJ8 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0045003370659 LJ10 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0016003698250 DQ8 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0033002912076 GS9 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0015003683959 DQ7 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0013003623125 DQ5 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0050003435047 LJ5 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0032002858695 GS8 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0037003084231 KM2 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0078003777182 YJ9 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0025002882595 GS1 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0061003748759 TM2 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0052003630424 LJ7 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0066003787590 TM7 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0017003745548 DQ9 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0057004368383 LUPWRUS00002 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0026002900688 GS2 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0038002975642 KM3 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0060003610329 TM1 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0072003793102 YJ3 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0027002897160 GS3 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0040003208901 KM5 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0049003716695 LJ4 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0022003294914 FAMICHN00002 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0054003383844 LJ9 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0029002730166 GS5 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0058004550277 LUPWRUS00003 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0073003717124 YJ4 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0031002932738 GS7 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0009003683788 DQ1 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0007003136139 Dingo T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0077003766844 YJ8 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0055004563068 LUPWCHN00001 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0068003655721 TM9 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0006004250900 CRW T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0024002913998 GS10 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0064003726221 TM5 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0076003806807 YJ7 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0069003814250 YJ10 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0046003443655 LJ1 Y ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0020003662324 FAMBTIM00001 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
snp_cf0002002454692 CID1 T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-08-02 2014-08-02
snp_cf0005004408673 CHW T ATGCGTCGAAGCCTTCTGCCTAAACTTCTC GCCAGGTGTTCCACACGCTCCAGCCTCCGA 2014-07-19 2014-07-19
6.Fasta Information
TTGCCATAAG CCCACGTTTC ATGCGTCGAA GCCTTCTGCC TAAACTTCTC
T
GCCAGGTGTT CCACACGCTC CAGCCTCCGA ATCTCATTCA GCAGCCATTC