e.g. 1:1246..9423
SNP Detail For snp_cf0042001612179    [See in GBrowse]
1.General Information
SNP ID: snp_cf0042001612179
Organism: Canis familiaris
Individual: KM7
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: TGGCATAGTGATCAAGCTTGTTTCTCCTGA
3'flank: GGTGCTCTTTCGAGGATATTTGGGCTGCCT
3.Reference Map information
Chrom Position Reference KM7
Chr2 2677929 A R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000003753 196 - A CDS
ENSCAFG00000003737 423428 + A intron
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000006031 169 TTC => CTC ENSCAFP00000030971 57 F => L
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0038001213674 KM3 G TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0006001796871 CRW G TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0048001471347 LJ3 G TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0032001190594 GS8 G TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0025001188177 GS1 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0060001528239 TM1 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0002001020875 CID1 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-08-02 2014-08-02
snp_cf0028001147626 GS4 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0039001271206 KM4 G TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0037001293859 KM2 G TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0078001580059 YJ9 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0033001210968 GS9 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0031001207073 GS7 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0014001515800 DQ6 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0061001571465 TM2 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0059001537058 TM10 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0054001384690 LJ9 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0041001557634 KM6 G TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0022001404643 FAMICHN00002 G TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0034001823286 ISW R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0062001559903 TM3 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0019001185802 FAMBGSD00001 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0036001210234 KM1 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0069001598369 YJ10 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0024001236474 GS10 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0073001534826 YJ4 G TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0011001568704 DQ3 G TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0053001508363 LJ8 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0047001501453 LJ2 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0066001577989 TM7 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0076001597008 YJ7 G TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0043001303239 KM8 G TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0009001544922 DQ1 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0020001536080 FAMBTIM00001 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0070001636334 YJ1 G TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0067001519764 TM8 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0049001556550 LJ4 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0052001511648 LJ7 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0013001470002 DQ5 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0057001859073 LUPWRUS00002 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0058001937165 LUPWRUS00003 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0072001590779 YJ3 G TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0077001568668 YJ8 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0016001546365 DQ8 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0074001566306 YJ5 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0051001539592 LJ6 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0075001584684 YJ6 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
snp_cf0056001956884 LUPWRUS00001 R TGGCATAGTGATCAAGCTTGTTTCTCCTGA GGTGCTCTTTCGAGGATATTTGGGCTGCCT 2014-07-19 2014-07-19
6.Fasta Information
AGTTAGGCGG AACTTGATGA TGGCATAGTG ATCAAGCTTG TTTCTCCTGA
R
GGTGCTCTTT CGAGGATATT TGGGCTGCCT TCAGAGATGC AGGGTCTTGG