e.g. 1:1246..9423
SNP Detail For snp_cf0042001615170    [See in GBrowse]
1.General Information
SNP ID: snp_cf0042001615170
Organism: Canis familiaris
Individual: KM7
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: TAAAGGAAAACCTTACCTAATATAACACCC
3'flank: GTGCACCTCTATAATAGCTTGGAGTTAATG
3.Reference Map information
Chrom Position Reference KM7
Chr2 6078635 G T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000028839 34123 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000043572 245 CCG => CAG ENSCAFP00000036267 82 P => Q
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0037001295315 KM2 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0052001513519 LJ7 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0036001211427 KM1 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0072001592366 YJ3 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0046001439621 LJ1 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0051001542021 LJ6 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0078001582081 YJ9 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0063001529532 TM4 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0062001562059 TM3 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0060001530313 TM1 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0049001557820 LJ4 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0055001935804 LUPWCHN00001 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0027001208109 GS3 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0057001861156 LUPWRUS00002 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0010001531042 DQ2 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0020001537418 FAMBTIM00001 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0012001544962 DQ4 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0008001541288 DQ10 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0034001825811 ISW T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0047001503417 LJ2 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0030001203813 GS6 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0025001189478 GS1 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0004001300991 Basenji T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0075001585994 YJ6 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0050001442392 LJ5 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0029001131094 GS5 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0031001208758 GS7 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0038001215174 KM3 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0039001272768 KM4 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0059001538220 TM10 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0009001547028 DQ1 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0066001580121 TM7 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0015001547420 DQ7 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0013001472111 DQ5 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0064001564567 TM5 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0071001582526 YJ2 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0017001558825 DQ9 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0070001637906 YJ1 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0023001445109 FAMICHN00003 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0061001572905 TM2 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0053001509448 LJ8 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0035001500362 KM10 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0040001372628 KM5 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0024001237834 GS10 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0022001405904 FAMICHN00002 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0076001598613 YJ7 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0016001548174 DQ8 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0045001399969 LJ10 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0073001536363 YJ4 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0065001527400 TM6 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0018001304958 FAMBBEM00001 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0043001304241 KM8 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0006001799057 CRW T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0069001600585 YJ10 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0028001149300 GS4 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0014001517970 DQ6 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0068001501091 TM9 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0044001370367 KM9 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0056001960215 LUPWRUS00001 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0041001560377 KM6 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0067001520970 TM8 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0032001191693 GS8 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0019001187434 FAMBGSD00001 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0033001212691 GS9 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0048001472309 LJ3 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0058001939465 LUPWRUS00003 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0011001570609 DQ3 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0077001570702 YJ8 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0005001874090 CHW T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0054001386650 LJ9 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0026001184812 GS2 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0074001567711 YJ5 T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
snp_cf0007001331548 Dingo T TAAAGGAAAACCTTACCTAATATAACACCC GTGCACCTCTATAATAGCTTGGAGTTAATG 2014-07-19 2014-07-19
6.Fasta Information
ATATTTTTCA AGCATTATCT TAAAGGAAAA CCTTACCTAA TATAACACCC
T
GTGCACCTCT ATAATAGCTT GGAGTTAATG TTCTGAACCT TTCTTGACCA