e.g. 1:1246..9423
SNP Detail For snp_cf0042001615402    [See in GBrowse]
1.General Information
SNP ID: snp_cf0042001615402
Organism: Canis familiaris
Individual: KM7
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: M
5'flank: AATATCCATTTCCGTTTGACTGGTTTTTAA
3'flank: TCTCCATAGAAAGGAAGCTCTCCATTTTCA
3.Reference Map information
Chrom Position Reference KM7
Chr2 6280972 A M
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000014021 142937 - A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000022255 3279 GAT => GAG ENSCAFP00000020668 1093 D => E
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0030001204017 GS6 M AATATCCATTTCCGTTTGACTGGTTTTTAA TCTCCATAGAAAGGAAGCTCTCCATTTTCA 2014-07-19 2014-07-19
snp_cf0037001295527 KM2 M AATATCCATTTCCGTTTGACTGGTTTTTAA TCTCCATAGAAAGGAAGCTCTCCATTTTCA 2014-07-19 2014-07-19
snp_cf0018001305375 FAMBBEM00001 M AATATCCATTTCCGTTTGACTGGTTTTTAA TCTCCATAGAAAGGAAGCTCTCCATTTTCA 2014-07-19 2014-07-19
snp_cf0028001149476 GS4 C AATATCCATTTCCGTTTGACTGGTTTTTAA TCTCCATAGAAAGGAAGCTCTCCATTTTCA 2014-07-19 2014-07-19
snp_cf0032001191890 GS8 M AATATCCATTTCCGTTTGACTGGTTTTTAA TCTCCATAGAAAGGAAGCTCTCCATTTTCA 2014-07-19 2014-07-19
snp_cf0025001189675 GS1 M AATATCCATTTCCGTTTGACTGGTTTTTAA TCTCCATAGAAAGGAAGCTCTCCATTTTCA 2014-07-19 2014-07-19
snp_cf0002001021818 CID1 M AATATCCATTTCCGTTTGACTGGTTTTTAA TCTCCATAGAAAGGAAGCTCTCCATTTTCA 2014-08-02 2014-08-02
snp_cf0036001211597 KM1 M AATATCCATTTCCGTTTGACTGGTTTTTAA TCTCCATAGAAAGGAAGCTCTCCATTTTCA 2014-07-19 2014-07-19
snp_cf0004001301233 Basenji C AATATCCATTTCCGTTTGACTGGTTTTTAA TCTCCATAGAAAGGAAGCTCTCCATTTTCA 2014-07-19 2014-07-19
snp_cf0024001238008 GS10 C AATATCCATTTCCGTTTGACTGGTTTTTAA TCTCCATAGAAAGGAAGCTCTCCATTTTCA 2014-07-19 2014-07-19
snp_cf0031001208934 GS7 C AATATCCATTTCCGTTTGACTGGTTTTTAA TCTCCATAGAAAGGAAGCTCTCCATTTTCA 2014-07-19 2014-07-19
snp_cf0019001187582 FAMBGSD00001 C AATATCCATTTCCGTTTGACTGGTTTTTAA TCTCCATAGAAAGGAAGCTCTCCATTTTCA 2014-07-19 2014-07-19
snp_cf0027001208284 GS3 C AATATCCATTTCCGTTTGACTGGTTTTTAA TCTCCATAGAAAGGAAGCTCTCCATTTTCA 2014-07-19 2014-07-19
snp_cf0044001370658 KM9 M AATATCCATTTCCGTTTGACTGGTTTTTAA TCTCCATAGAAAGGAAGCTCTCCATTTTCA 2014-07-19 2014-07-19
snp_cf0075001586283 YJ6 M AATATCCATTTCCGTTTGACTGGTTTTTAA TCTCCATAGAAAGGAAGCTCTCCATTTTCA 2014-07-19 2014-07-19
snp_cf0040001372809 KM5 M AATATCCATTTCCGTTTGACTGGTTTTTAA TCTCCATAGAAAGGAAGCTCTCCATTTTCA 2014-07-19 2014-07-19
snp_cf0033001212889 GS9 M AATATCCATTTCCGTTTGACTGGTTTTTAA TCTCCATAGAAAGGAAGCTCTCCATTTTCA 2014-07-19 2014-07-19
snp_cf0026001184986 GS2 C AATATCCATTTCCGTTTGACTGGTTTTTAA TCTCCATAGAAAGGAAGCTCTCCATTTTCA 2014-07-19 2014-07-19
snp_cf0073001536772 YJ4 M AATATCCATTTCCGTTTGACTGGTTTTTAA TCTCCATAGAAAGGAAGCTCTCCATTTTCA 2014-07-19 2014-07-19
snp_cf0043001304588 KM8 M AATATCCATTTCCGTTTGACTGGTTTTTAA TCTCCATAGAAAGGAAGCTCTCCATTTTCA 2014-07-19 2014-07-19
6.Fasta Information
TGTTTTAGCA TATTAATCTG AATATCCATT TCCGTTTGAC TGGTTTTTAA
M
TCTCCATAGA AAGGAAGCTC TCCATTTTCA TATTTACTTA ACATCCTTCT