e.g. 1:1246..9423
SNP Detail For snp_cf0042001615408    [See in GBrowse]
1.General Information
SNP ID: snp_cf0042001615408
Organism: Canis familiaris
Individual: KM7
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: M
5'flank: ATACATTTCTTTAGACTTTCCTTTTCATCG
3'flank: TAGGCTTTGAAAAAAATTTTTCAAGAAAAT
3.Reference Map information
Chrom Position Reference KM7
Chr2 6284096 C M
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000014021 139813 - C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000022255 3095 AGC => ATC ENSCAFP00000020668 1032 S => I
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0043001304594 KM8 M ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0036001211602 KM1 M ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0056001960666 LUPWRUS00001 A ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0041001560585 KM6 M ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0024001238014 GS10 A ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0019001187588 FAMBGSD00001 A ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0037001295533 KM2 M ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0031001208940 GS7 A ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0033001212895 GS9 M ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0016001548692 DQ8 M ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0012001545470 DQ4 M ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0057001861651 LUPWRUS00002 A ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0030001204023 GS6 M ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0055001936297 LUPWCHN00001 M ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0028001149482 GS4 A ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0005001874502 CHW A ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0044001370664 KM9 M ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0027001208290 GS3 A ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0058001939983 LUPWRUS00003 M ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0018001305380 FAMBBEM00001 M ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0025001189680 GS1 M ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0032001191896 GS8 M ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0026001184992 GS2 A ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0040001372815 KM5 M ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0004001301239 Basenji A ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0073001536778 YJ4 M ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0008001541777 DQ10 M ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0054001387184 LJ9 M ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0075001586289 YJ6 M ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0034001826277 ISW M ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
snp_cf0049001558320 LJ4 M ATACATTTCTTTAGACTTTCCTTTTCATCG TAGGCTTTGAAAAAAATTTTTCAAGAAAAT 2014-07-19 2014-07-19
6.Fasta Information
CCAGAGATTG TTTTAACTCC ATACATTTCT TTAGACTTTC CTTTTCATCG
M
TAGGCTTTGA AAAAAATTTT TCAAGAAAAT TAGTTTCAAA AATCTAGAGA