e.g. 1:1246..9423
SNP Detail For snp_cf0042001615492    [See in GBrowse]
1.General Information
SNP ID: snp_cf0042001615492
Organism: Canis familiaris
Individual: KM7
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: TTAAGGTCGTCTGTCCAAATTCTCCGGATG
3'flank: GGACTCAATTTTTGTCATTGGTTGTGATAC
3.Reference Map information
Chrom Position Reference KM7
Chr2 6324312 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000014021 99597 - C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000022255 733 GCA => ACA ENSCAFP00000020668 245 A => T
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0057001861740 LUPWRUS00002 T TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0049001558406 LJ4 Y TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0036001211687 KM1 Y TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0025001189766 GS1 Y TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0055001936382 LUPWCHN00001 Y TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0044001370750 KM9 Y TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0031001209026 GS7 T TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0041001560641 KM6 Y TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0032001191982 GS8 Y TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0019001187672 FAMBGSD00001 T TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0026001185078 GS2 T TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0040001372902 KM5 Y TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0008001541864 DQ10 Y TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0005001874586 CHW T TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0075001586374 YJ6 Y TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0043001304680 KM8 Y TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0012001545557 DQ4 Y TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0054001387271 LJ9 Y TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0056001960757 LUPWRUS00001 Y TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0018001305463 FAMBBEM00001 Y TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0028001149568 GS4 T TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0030001204109 GS6 Y TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0037001295620 KM2 Y TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0004001301321 Basenji T TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0024001238100 GS10 T TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0033001212980 GS9 Y TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0027001208376 GS3 T TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0058001940068 LUPWRUS00003 Y TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
snp_cf0016001548780 DQ8 Y TTAAGGTCGTCTGTCCAAATTCTCCGGATG GGACTCAATTTTTGTCATTGGTTGTGATAC 2014-07-19 2014-07-19
6.Fasta Information
ATTAATATTT TCTTTATCCA TTAAGGTCGT CTGTCCAAAT TCTCCGGATG
Y
GGACTCAATT TTTGTCATTG GTTGTGATAC AAATGGGCAT TTATCATCAA