e.g. 1:1246..9423
SNP Detail For snp_cf0043000538387    [See in GBrowse]
1.General Information
SNP ID: snp_cf0043000538387
Organism: Canis familiaris
Individual: KM8
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: TGAATAAGGATGAGTTTCCAACCTCAAAAT
3'flank: TTTCTGTGGAAAGTTGTCTAAACCTAAAGT
3.Reference Map information
Chrom Position Reference KM8
Chr13 1677365 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000507 575553 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000043554 6212 TGT => TAT ENSCAFP00000038220 2071 C => Y
+ ENSCAFT00000000811 6287 TGT => TAT ENSCAFP00000000746 2096 C => Y
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0050000606630 LJ5 A TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0076000681318 YJ7 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0008000658845 DQ10 A TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0036000516606 KM1 A TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0054000591227 LJ9 A TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0048000631849 LJ3 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0057000817639 LUPWRUS00002 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0053000646293 LJ8 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0073000671833 YJ4 A TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0051000664920 LJ6 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0065000645163 TM6 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0044000585602 KM9 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0019000515371 FAMBGSD00001 A TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0030000528323 GS6 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0052000643219 LJ7 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0026000497041 GS2 A TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0074000672501 YJ5 A TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0077000676847 YJ8 A TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0049000664879 LJ4 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0075000685339 YJ6 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0064000672553 TM5 A TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0024000539688 GS10 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0012000663018 DQ4 A TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0038000543077 KM3 A TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0046000601183 LJ1 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0027000516361 GS3 A TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0041000642456 KM6 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0022000589302 FAMICHN00002 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0072000684233 YJ3 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0070000698370 YJ1 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0031000526964 GS7 A TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0028000492985 GS4 A TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0007000555891 Dingo A TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0060000675885 TM1 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0059000673126 TM10 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0039000510493 KM4 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0002000432378 CID1 A TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-08-02 2014-08-02
snp_cf0071000675942 YJ2 A TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0069000685676 YJ10 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0017000676224 DQ9 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0029000461861 GS5 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0014000648673 DQ6 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0037000532322 KM2 A TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0035000634462 KM10 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0040000581660 KM5 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0025000489431 GS1 A TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0042000665262 KM7 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
snp_cf0066000677961 TM7 R TGAATAAGGATGAGTTTCCAACCTCAAAAT TTTCTGTGGAAAGTTGTCTAAACCTAAAGT 2014-07-19 2014-07-19
6.Fasta Information
AGCCCCATTG GACACCATGC TGAATAAGGA TGAGTTTCCA ACCTCAAAAT
R
TTTCTGTGGA AAGTTGTCTA AACCTAAAGT TCATGGTGAT GGAGCACAAA