e.g. 1:1246..9423
SNP Detail For snp_cf0044001367388    [See in GBrowse]
1.General Information
SNP ID: snp_cf0044001367388
Organism: Canis familiaris
Individual: KM9
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: S
5'flank: TGTGTGGGTTGCGTCCCTTTCTTGCTCATA
3'flank: CTACGGCGTCTCGGTAAGCTCCTCGGGAAG
3.Reference Map information
Chrom Position Reference KM9
Chr2 1030757 C S
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000028469 47 - C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000042766 47 GGT => GCT ENSCAFP00000042047 16 G => A
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0052001509999 LJ7 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0058001935058 LUPWRUS00003 G TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0027001204834 GS3 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0001000660334 solidGW1 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-08-01 2014-08-01
snp_cf0005001870796 CHW G TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0055001932023 LUPWCHN00001 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0068001498300 TM9 G TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0045001397089 LJ10 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0020001533985 FAMBTIM00001 G TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0017001556909 DQ9 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0053001506780 LJ8 G TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0062001558062 TM3 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0004001297937 Basenji G TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0032001189077 GS8 G TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0072001589006 YJ3 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0067001518170 TM8 G TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0009001543214 DQ1 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0030001199895 GS6 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0065001525249 TM6 G TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0075001582973 YJ6 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0023001442463 FAMICHN00003 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0033001209098 GS9 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0078001578063 YJ9 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0035001496682 KM10 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0034001821415 ISW S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0049001554715 LJ4 G TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0039001269281 KM4 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0019001183956 FAMBGSD00001 G TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0029001127287 GS5 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0057001857532 LUPWRUS00002 G TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0025001186484 GS1 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0006001795194 CRW G TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0028001145753 GS4 G TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0060001526440 TM1 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0031001205200 GS7 G TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0059001535452 TM10 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0026001181502 GS2 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0043001302035 KM8 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0073001533400 YJ4 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0054001383084 LJ9 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0046001437347 LJ1 G TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0036001208655 KM1 G TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0040001369755 KM5 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0047001499625 LJ2 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
snp_cf0051001538085 LJ6 S TGTGTGGGTTGCGTCCCTTTCTTGCTCATA CTACGGCGTCTCGGTAAGCTCCTCGGGAAG 2014-07-19 2014-07-19
6.Fasta Information
CCAGCCCCAG GCGGATGGGG TGTGTGGGTT GCGTCCCTTT CTTGCTCATA
S
CTACGGCGTC TCGGTAAGCT CCTCGGGAAG TAGCTATCGT GTTTTCGATC