e.g. 1:1246..9423
SNP Detail For snp_cf0044000585270    [See in GBrowse]
1.General Information
SNP ID: snp_cf0044000585270
Organism: Canis familiaris
Individual: KM9
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs22238688  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: AGCCCTCAGAAAGTAAAATCCAAAGAAGTA
3'flank: TGTGTTGGGAACAAGAAGGAACTACCGTTG
3.Reference Map information
Chrom Position Reference KM9
Chr13 1176744 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000507 74932 + T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000043554 1270 TTG => CTG ENSCAFP00000038220 424 L => L
+ ENSCAFT00000000811 1270 TTG => CTG ENSCAFP00000000746 424 L => L
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0076000680965 YJ7 Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0031000526767 GS7 C AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0007000555632 Dingo Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0030000528032 GS6 Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0075000685043 YJ6 Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0060000675526 TM1 Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0017000675879 DQ9 Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0077000676630 YJ8 C AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0008000658621 DQ10 C AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0028000492790 GS4 C AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0059000672812 TM10 Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0003000357651 dbSNP139 C AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0073000671539 YJ4 Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0050000606406 LJ5 C AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0072000683868 YJ3 Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0012000662814 DQ4 C AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0024000539397 GS10 Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0054000591013 LJ9 C AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0049000664534 LJ4 Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0038000542897 KM3 C AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0023000621884 FAMICHN00003 Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0042000664986 KM7 Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0029000461569 GS5 Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0064000672271 TM5 Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0002000432208 CID1 C AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-08-02 2014-08-02
snp_cf0048000631562 LJ3 Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0019000515180 FAMBGSD00001 C AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0052000642909 LJ7 Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0014000648355 DQ6 Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0035000634120 KM10 Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0005000814336 CHW Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0026000496849 GS2 C AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0066000677606 TM7 Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0037000532101 KM2 C AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0036000516426 KM1 C AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0043000538041 KM8 Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0025000489253 GS1 C AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0027000516168 GS3 C AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0041000642156 KM6 Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0039000510202 KM4 Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0040000581367 KM5 Y AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
snp_cf0071000675733 YJ2 C AGCCCTCAGAAAGTAAAATCCAAAGAAGTA TGTGTTGGGAACAAGAAGGAACTACCGTTG 2014-07-19 2014-07-19
6.Fasta Information
AAGCTGAGAG TAGTTATTAT AGCCCTCAGA AAGTAAAATC CAAAGAAGTA
Y
TGTGTTGGGA ACAAGAAGGA ACTACCGTTG AGGTAATCAT TCAACATTGA