e.g. 1:1246..9423
SNP Detail For snp_cf0044000585643    [See in GBrowse]
1.General Information
SNP ID: snp_cf0044000585643
Organism: Canis familiaris
Individual: KM9
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs22277807  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: CTGTAAACTTCTTGAATGCAGAAATGTTAC
3'flank: ATGCAAAGCATGGTGAAATCCTTCAGCATC
3.Reference Map information
Chrom Position Reference KM9
Chr13 1744838 A R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000507 643026 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000043554 7602 ACA => ACG ENSCAFP00000038220 2534 T => T
+ ENSCAFT00000000811 7677 ACA => ACG ENSCAFP00000000746 2559 T => T
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0030000528356 GS6 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0076000681359 YJ7 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0016000663180 DQ8 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0013000634183 DQ5 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0004000555198 Basenji G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0035000634506 KM10 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0046000601214 LJ1 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0020000652499 FAMBTIM00001 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0051000664966 LJ6 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0006000769329 CRW G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0067000642388 TM8 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0041000642489 KM6 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0055000833325 LUPWCHN00001 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0034000783661 ISW G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0066000678004 TM7 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0023000622259 FAMICHN00003 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0057000817669 LUPWRUS00002 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0075000685372 YJ6 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0021000632837 FAMICHN00001 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0052000643253 LJ7 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0011000669827 DQ3 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0063000655305 TM4 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0001000301223 solidGW1 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-08-01 2014-08-01
snp_cf0015000665699 DQ7 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0065000645207 TM6 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0053000646333 LJ8 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0024000539724 GS10 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0078000678038 YJ9 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0009000665268 DQ1 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0056000841895 LUPWRUS00001 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0047000632781 LJ2 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0049000664921 LJ4 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0010000664372 DQ2 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0039000510525 KM4 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0070000698416 YJ1 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0062000665383 TM3 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0029000461895 GS5 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0017000676258 DQ9 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0032000502650 GS8 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0072000684274 YJ3 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0003000357922 dbSNP139 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0043000538431 KM8 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0060000675928 TM1 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0033000522746 GS9 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0005000814704 CHW G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0040000581693 KM5 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0042000665292 KM7 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0018000553220 FAMBBEM00001 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0061000676436 TM2 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0069000685719 YJ10 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0014000648705 DQ6 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0058000835186 LUPWRUS00003 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0059000673161 TM10 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0048000631881 LJ3 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0068000630525 TM9 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0045000593239 LJ10 G CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
snp_cf0022000589341 FAMICHN00002 R CTGTAAACTTCTTGAATGCAGAAATGTTAC ATGCAAAGCATGGTGAAATCCTTCAGCATC 2014-07-19 2014-07-19
6.Fasta Information
CGATTCTCAT CTCAAGCTGA CTGTAAACTT CTTGAATGCA GAAATGTTAC
R
ATGCAAAGCA TGGTGAAATC CTTCAGCATC TTCGGGCAGA TTGCCATTTC