e.g. 1:1246..9423
SNP Detail For snp_cf0044000585716    [See in GBrowse]
1.General Information
SNP ID: snp_cf0044000585716
Organism: Canis familiaris
Individual: KM9
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: A
5'flank: TGTGAAAACATATCACTATATGGTTGATCC
3'flank: CATTTTGCTCAAGTCTTCATTAGTAAATTT
3.Reference Map information
Chrom Position Reference KM9
Chr13 1833693 G A
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000507 731881 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000043554 11913 CCG => CCA ENSCAFP00000038220 3971 P => P
+ ENSCAFT00000000811 11988 CCG => CCA ENSCAFP00000000746 3996 P => P
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0055000833378 LUPWCHN00001 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0076000681436 YJ7 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0023000622325 FAMICHN00003 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0030000528395 GS6 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0058000835235 LUPWRUS00003 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0048000631925 LJ3 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0016000663186 DQ8 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0045000593293 LJ10 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0053000646401 LJ8 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0005000814764 CHW A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0068000630575 TM9 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0052000643295 LJ7 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0057000817708 LUPWRUS00002 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0026000497107 GS2 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0072000684345 YJ3 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0049000664998 LJ4 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0060000676000 TM1 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0051000665030 LJ6 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0031000527027 GS7 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0047000632855 LJ2 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0066000678081 TM7 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0078000678089 YJ9 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0054000591290 LJ9 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0061000676494 TM2 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0028000493047 GS4 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0075000685413 YJ6 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0017000676316 DQ9 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0041000642534 KM6 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0013000634248 DQ5 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0006000769379 CRW R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0020000652544 FAMBTIM00001 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0067000642439 TM8 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0069000685781 YJ10 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0024000539763 GS10 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0037000532386 KM2 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0007000555958 Dingo R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0036000516665 KM1 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0071000676008 YJ2 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0025000489492 GS1 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0019000515436 FAMBGSD00001 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0040000581734 KM5 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0050000606691 LJ5 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0029000461935 GS5 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0070000698491 YJ1 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0004000555253 Basenji A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0077000676915 YJ8 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0043000538506 KM8 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0021000632889 FAMICHN00001 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0011000669879 DQ3 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0035000634576 KM10 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0059000673203 TM10 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0009000665331 DQ1 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0010000664442 DQ2 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0022000589411 FAMICHN00002 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0062000665439 TM3 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0063000655363 TM4 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0008000658912 DQ10 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0012000663080 DQ4 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0042000665336 KM7 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0015000665714 DQ7 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0046000601246 LJ1 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0027000516423 GS3 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0014000648756 DQ6 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0056000841952 LUPWRUS00001 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0073000671902 YJ4 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0065000645277 TM6 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0064000672619 TM5 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0018000553275 FAMBBEM00001 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0034000783672 ISW R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0038000543135 KM3 A TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
snp_cf0039000510567 KM4 R TGTGAAAACATATCACTATATGGTTGATCC CATTTTGCTCAAGTCTTCATTAGTAAATTT 2014-07-19 2014-07-19
6.Fasta Information
GTGGAACCTC TCCCGTCCAC TGTGAAAACA TATCACTATA TGGTTGATCC
A
CATTTTGCTC AAGTCTTCAT TAGTAAATTT ACCATGGTAA AAAATAAAGC