e.g. 1:1246..9423
SNP Detail For snp_cf0045000000002    [See in GBrowse]
1.General Information
SNP ID: snp_cf0045000000002
Organism: Canis familiaris
Individual: LJ10
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: GAGAGGTTTCGGGAAAAGCATGTGTAAGCA
3'flank: TGGGCCTGAACTCCCGTGTATCTGAGTTGA
3.Reference Map information
Chrom Position Reference LJ10
Chr1 6400 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0057000000002 LUPWRUS00002 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0016000000002 DQ8 Y GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0074000000002 YJ5 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0010000000003 DQ2 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0036000000001 KM1 Y GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0077000000002 YJ8 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0004000000002 Basenji Y GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0051000000002 LJ6 Y GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0060000000003 TM1 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0050000000002 LJ5 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0024000000002 GS10 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0071000000002 YJ2 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0015000000002 DQ7 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0029000000002 GS5 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0053000000001 LJ8 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0006000000002 CRW C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0035000000002 KM10 Y GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0009000000002 DQ1 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0023000000002 FAMICHN00003 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0055000000002 LUPWCHN00001 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0058000000001 LUPWRUS00003 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0026000000002 GS2 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0073000000002 YJ4 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0049000000003 LJ4 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0040000000002 KM5 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0072000000002 YJ3 Y GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0011000000002 DQ3 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0075000000002 YJ6 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0046000000002 LJ1 Y GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0014000000003 DQ6 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0069000000002 YJ10 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0005000000002 CHW C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0007000000002 Dingo C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0039000000002 KM4 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0078000000002 YJ9 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0019000000002 FAMBGSD00001 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0034000000002 ISW C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
snp_cf0066000000002 TM7 C GAGAGGTTTCGGGAAAAGCATGTGTAAGCA TGGGCCTGAACTCCCGTGTATCTGAGTTGA 2014-07-19 2014-07-19
6.Fasta Information
ATCCTTATGT TAGTGGCTGG GAGAGGTTTC GGGAAAAGCA TGTGTAAGCA
C
TGGGCCTGAA CTCCCGTGTA TCTGAGTTGA ATACAGCGAT TTCCAACGGC