e.g. 1:1246..9423
SNP Detail For snp_cf0045000000005    [See in GBrowse]
1.General Information
SNP ID: snp_cf0045000000005
Organism: Canis familiaris
Individual: LJ10
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: W
5'flank: ACGTGAGAAGGTAGCTAACGCCTTGTCCAA
3'flank: AGCATCTTACTTCTGAGAGTTGAGCTCACC
3.Reference Map information
Chrom Position Reference LJ10
Chr1 30097 T W
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0048000000005 LJ3 W ACGTGAGAAGGTAGCTAACGCCTTGTCCAA AGCATCTTACTTCTGAGAGTTGAGCTCACC 2014-07-19 2014-07-19
snp_cf0077000000008 YJ8 A ACGTGAGAAGGTAGCTAACGCCTTGTCCAA AGCATCTTACTTCTGAGAGTTGAGCTCACC 2014-07-19 2014-07-19
snp_cf0038000000005 KM3 W ACGTGAGAAGGTAGCTAACGCCTTGTCCAA AGCATCTTACTTCTGAGAGTTGAGCTCACC 2014-07-19 2014-07-19
snp_cf0061000000002 TM2 W ACGTGAGAAGGTAGCTAACGCCTTGTCCAA AGCATCTTACTTCTGAGAGTTGAGCTCACC 2014-07-19 2014-07-19
snp_cf0076000000003 YJ7 A ACGTGAGAAGGTAGCTAACGCCTTGTCCAA AGCATCTTACTTCTGAGAGTTGAGCTCACC 2014-07-19 2014-07-19
snp_cf0041000000004 KM6 W ACGTGAGAAGGTAGCTAACGCCTTGTCCAA AGCATCTTACTTCTGAGAGTTGAGCTCACC 2014-07-19 2014-07-19
snp_cf0036000000006 KM1 W ACGTGAGAAGGTAGCTAACGCCTTGTCCAA AGCATCTTACTTCTGAGAGTTGAGCTCACC 2014-07-19 2014-07-19
snp_cf0039000000007 KM4 W ACGTGAGAAGGTAGCTAACGCCTTGTCCAA AGCATCTTACTTCTGAGAGTTGAGCTCACC 2014-07-19 2014-07-19
snp_cf0034000000009 ISW W ACGTGAGAAGGTAGCTAACGCCTTGTCCAA AGCATCTTACTTCTGAGAGTTGAGCTCACC 2014-07-19 2014-07-19
snp_cf0066000000007 TM7 W ACGTGAGAAGGTAGCTAACGCCTTGTCCAA AGCATCTTACTTCTGAGAGTTGAGCTCACC 2014-07-19 2014-07-19
snp_cf0037000000004 KM2 W ACGTGAGAAGGTAGCTAACGCCTTGTCCAA AGCATCTTACTTCTGAGAGTTGAGCTCACC 2014-07-19 2014-07-19
snp_cf0063000000003 TM4 W ACGTGAGAAGGTAGCTAACGCCTTGTCCAA AGCATCTTACTTCTGAGAGTTGAGCTCACC 2014-07-19 2014-07-19
snp_cf0047000000003 LJ2 A ACGTGAGAAGGTAGCTAACGCCTTGTCCAA AGCATCTTACTTCTGAGAGTTGAGCTCACC 2014-07-19 2014-07-19
snp_cf0075000000008 YJ6 A ACGTGAGAAGGTAGCTAACGCCTTGTCCAA AGCATCTTACTTCTGAGAGTTGAGCTCACC 2014-07-19 2014-07-19
snp_cf0030000000002 GS6 W ACGTGAGAAGGTAGCTAACGCCTTGTCCAA AGCATCTTACTTCTGAGAGTTGAGCTCACC 2014-07-19 2014-07-19
6.Fasta Information
CTACATACTA AGTTCAATAT ACGTGAGAAG GTAGCTAACG CCTTGTCCAA
W
AGCATCTTAC TTCTGAGAGT TGAGCTCACC CTCAGTCTCT CACAGTTCCA