e.g. 1:1246..9423
SNP Detail For snp_cf0045000000007    [See in GBrowse]
1.General Information
SNP ID: snp_cf0045000000007
Organism: Canis familiaris
Individual: LJ10
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: S
5'flank: TGAGACGCAAGTTAACAATGCAGACCTGGA
3'flank: GGTATCTCCAGGTGCAGTAGAGTGGTAATC
3.Reference Map information
Chrom Position Reference LJ10
Chr1 32439 C S
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0071000000007 YJ2 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0013000000005 DQ5 G TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0009000000011 DQ1 G TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0010000000009 DQ2 G TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0068000000007 TM9 G TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0023000000013 FAMICHN00003 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0027000000012 GS3 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0040000000012 KM5 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0053000000006 LJ8 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0060000000008 TM1 G TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0046000000010 LJ1 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0018000000009 FAMBBEM00001 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0039000000010 KM4 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0012000000006 DQ4 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0043000000010 KM8 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0059000000006 TM10 G TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0044000000005 KM9 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0019000000011 FAMBGSD00001 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0062000000004 TM3 G TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0064000000003 TM5 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0025000000010 GS1 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0067000000005 TM8 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0061000000007 TM2 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0016000000013 DQ8 G TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0017000000007 DQ9 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0032000000009 GS8 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0042000000012 KM7 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0041000000009 KM6 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0035000000008 KM10 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0036000000011 KM1 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0063000000008 TM4 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0049000000010 LJ4 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0078000000008 YJ9 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0038000000010 KM3 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0052000000008 LJ7 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
snp_cf0037000000009 KM2 S TGAGACGCAAGTTAACAATGCAGACCTGGA GGTATCTCCAGGTGCAGTAGAGTGGTAATC 2014-07-19 2014-07-19
6.Fasta Information
AGACGTTTGC CAGAGGCTTC TGAGACGCAA GTTAACAATG CAGACCTGGA
S
GGTATCTCCA GGTGCAGTAG AGTGGTAATC TTGGAACCTC CTGACTCAGA