e.g. 1:1246..9423
SNP Detail For snp_cf0047000000007    [See in GBrowse]
1.General Information
SNP ID: snp_cf0047000000007
Organism: Canis familiaris
Individual: LJ2
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: ATGGATCAGAGAGTTACAGGTTTGTATCTT
3'flank: TTTCGGCTTTCCATTCTATTCTATTGATCT
3.Reference Map information
Chrom Position Reference LJ2
Chr1 61277 C G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0045000000019 LJ10 S ATGGATCAGAGAGTTACAGGTTTGTATCTT TTTCGGCTTTCCATTCTATTCTATTGATCT 2014-07-19 2014-07-19
snp_cf0064000000017 TM5 S ATGGATCAGAGAGTTACAGGTTTGTATCTT TTTCGGCTTTCCATTCTATTCTATTGATCT 2014-07-19 2014-07-19
snp_cf0076000000021 YJ7 S ATGGATCAGAGAGTTACAGGTTTGTATCTT TTTCGGCTTTCCATTCTATTCTATTGATCT 2014-07-19 2014-07-19
snp_cf0041000000023 KM6 S ATGGATCAGAGAGTTACAGGTTTGTATCTT TTTCGGCTTTCCATTCTATTCTATTGATCT 2014-07-19 2014-07-19
snp_cf0061000000022 TM2 S ATGGATCAGAGAGTTACAGGTTTGTATCTT TTTCGGCTTTCCATTCTATTCTATTGATCT 2014-07-19 2014-07-19
snp_cf0035000000021 KM10 S ATGGATCAGAGAGTTACAGGTTTGTATCTT TTTCGGCTTTCCATTCTATTCTATTGATCT 2014-07-19 2014-07-19
snp_cf0074000000021 YJ5 S ATGGATCAGAGAGTTACAGGTTTGTATCTT TTTCGGCTTTCCATTCTATTCTATTGATCT 2014-07-19 2014-07-19
snp_cf0077000000023 YJ8 S ATGGATCAGAGAGTTACAGGTTTGTATCTT TTTCGGCTTTCCATTCTATTCTATTGATCT 2014-07-19 2014-07-19
snp_cf0011000000023 DQ3 S ATGGATCAGAGAGTTACAGGTTTGTATCTT TTTCGGCTTTCCATTCTATTCTATTGATCT 2014-07-19 2014-07-19
snp_cf0072000000017 YJ3 S ATGGATCAGAGAGTTACAGGTTTGTATCTT TTTCGGCTTTCCATTCTATTCTATTGATCT 2014-07-19 2014-07-19
snp_cf0039000000022 KM4 S ATGGATCAGAGAGTTACAGGTTTGTATCTT TTTCGGCTTTCCATTCTATTCTATTGATCT 2014-07-19 2014-07-19
snp_cf0063000000026 TM4 S ATGGATCAGAGAGTTACAGGTTTGTATCTT TTTCGGCTTTCCATTCTATTCTATTGATCT 2014-07-19 2014-07-19
snp_cf0044000000017 KM9 S ATGGATCAGAGAGTTACAGGTTTGTATCTT TTTCGGCTTTCCATTCTATTCTATTGATCT 2014-07-19 2014-07-19
snp_cf0056000000021 LUPWRUS00001 S ATGGATCAGAGAGTTACAGGTTTGTATCTT TTTCGGCTTTCCATTCTATTCTATTGATCT 2014-07-19 2014-07-19
snp_cf0078000000024 YJ9 S ATGGATCAGAGAGTTACAGGTTTGTATCTT TTTCGGCTTTCCATTCTATTCTATTGATCT 2014-07-19 2014-07-19
snp_cf0030000000018 GS6 S ATGGATCAGAGAGTTACAGGTTTGTATCTT TTTCGGCTTTCCATTCTATTCTATTGATCT 2014-07-19 2014-07-19
snp_cf0053000000020 LJ8 S ATGGATCAGAGAGTTACAGGTTTGTATCTT TTTCGGCTTTCCATTCTATTCTATTGATCT 2014-07-19 2014-07-19
snp_cf0033000000018 GS9 S ATGGATCAGAGAGTTACAGGTTTGTATCTT TTTCGGCTTTCCATTCTATTCTATTGATCT 2014-07-19 2014-07-19
snp_cf0015000000024 DQ7 S ATGGATCAGAGAGTTACAGGTTTGTATCTT TTTCGGCTTTCCATTCTATTCTATTGATCT 2014-07-19 2014-07-19
snp_cf0066000000023 TM7 S ATGGATCAGAGAGTTACAGGTTTGTATCTT TTTCGGCTTTCCATTCTATTCTATTGATCT 2014-07-19 2014-07-19
6.Fasta Information
TCCTGCCTTG TTGTCGATTA ATGGATCAGA GAGTTACAGG TTTGTATCTT
G
TTTCGGCTTT CCATTCTATT CTATTGATCT AAGCGTCTCC TGTTGGGAGA