e.g. 1:1246..9423
SNP Detail For snp_cf0005005242493    [See in GBrowse]
1.General Information
SNP ID: snp_cf0005005242493
Organism: Canis familiaris
Individual: CHW
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: AGCTCTCCGGCCGACCCACCACCTTTCTCA
3'flank: GCTGCACTGCACTTTAATTTTTTGTTGTTT
3.Reference Map information
Chrom Position Reference CHW
Chr8 169192 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000010670 27456 - G NON_CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0055005386689 LUPWCHN00001 R AGCTCTCCGGCCGACCCACCACCTTTCTCA GCTGCACTGCACTTTAATTTTTTGTTGTTT 2014-07-19 2014-07-19
snp_cf0001001924490 solidGW1 R AGCTCTCCGGCCGACCCACCACCTTTCTCA GCTGCACTGCACTTTAATTTTTTGTTGTTT 2014-08-01 2014-08-01
snp_cf0058005365854 LUPWRUS00003 R AGCTCTCCGGCCGACCCACCACCTTTCTCA GCTGCACTGCACTTTAATTTTTTGTTGTTT 2014-07-19 2014-07-19
snp_cf0056005411135 LUPWRUS00001 R AGCTCTCCGGCCGACCCACCACCTTTCTCA GCTGCACTGCACTTTAATTTTTTGTTGTTT 2014-07-19 2014-07-19
6.Fasta Information
CTCAATACCC TTGCACCTTC AGCTCTCCGG CCGACCCACC ACCTTTCTCA
R
GCTGCACTGC ACTTTAATTT TTTGTTGTTT TCAGCTAAAA TTAAAATACA