e.g. 1:1246..9423
SNP Detail For snp_cf0005005242497    [See in GBrowse]
1.General Information
SNP ID: snp_cf0005005242497
Organism: Canis familiaris
Individual: CHW
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs8627329  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: S
5'flank: CCTGCGCAGCCCATGTGGCTCCTGATAATG
3'flank: TGGGCTGTCCCCACGGCCACCCAGACTTCC
3.Reference Map information
Chrom Position Reference CHW
Chr8 171025 C S
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000010670 25623 - C NON_CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0013004292682 DQ5 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0043003676721 KM8 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0065004328869 TM6 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0012004350918 DQ4 G CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0046004075828 LJ1 G CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0003002494343 dbSNP139 G CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0001001924494 solidGW1 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-08-01 2014-08-01
snp_cf0072004479198 YJ3 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0044003845391 KM9 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0064004395253 TM5 G CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0075004459401 YJ6 G CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0021004181920 FAMICHN00001 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0062004366442 TM3 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0016004360150 DQ8 G CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0049004397382 LJ4 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0036003477288 KM1 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0056005411140 LUPWRUS00001 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0031003440373 GS7 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0042004517258 KM7 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0009004356976 DQ1 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0018003626643 FAMBBEM00001 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0014004321553 DQ6 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0010004377763 DQ2 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0068004306805 TM9 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0020004310939 FAMBTIM00001 G CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0015004358871 DQ7 G CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0059004350629 TM10 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0063004281810 TM4 G CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0052004293675 LJ7 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0054004007657 LJ9 G CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0008004426291 DQ10 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0074004380317 YJ5 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0037003627330 KM2 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0060004269488 TM1 G CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0041004329965 KM6 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0058005365857 LUPWRUS00003 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0004003644645 Basenji G CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0071004450216 YJ2 G CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0050004055073 LJ5 G CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0053004262263 LJ8 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0055005386693 LUPWCHN00001 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0061004420269 TM2 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0035004236910 KM10 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0017004406636 DQ9 G CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0067004304983 TM8 G CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
snp_cf0040003765006 KM5 S CCTGCGCAGCCCATGTGGCTCCTGATAATG TGGGCTGTCCCCACGGCCACCCAGACTTCC 2014-07-19 2014-07-19
6.Fasta Information
GAAAAAGAGG GCAGGAGGTC CCTGCGCAGC CCATGTGGCT CCTGATAATG
S
TGGGCTGTCC CCACGGCCAC CCAGACTTCC CAGGACAGGG CAGGCTCCAC