e.g. 1:1246..9423
SNP Detail For snp_cf0005000443775    [See in GBrowse]
1.General Information
SNP ID: snp_cf0005000443775
Organism: Canis familiaris
Individual: CHW
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: W
5'flank: GGCTACTGGGTGATGGGGCTGTGGAACCAC
3'flank: GTGAGTATTTTGTCCTGGACCCGCACCGCA
3.Reference Map information
Chrom Position Reference CHW
Chr11 269795 A W
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000012915 35173 + A intron
ENSCAFG00000012915 35173 + A CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000020497 1300 AGT => TGT ENSCAFP00000019022 434 S => C
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0062000373357 TM3 W GGCTACTGGGTGATGGGGCTGTGGAACCAC GTGAGTATTTTGTCCTGGACCCGCACCGCA 2014-07-19 2014-07-19
6.Fasta Information
CACAACTAAG CCCGGCCAGT GGCTACTGGG TGATGGGGCT GTGGAACCAC
W
GTGAGTATTT TGTCCTGGAC CCGCACCGCA TCGCGCTCAC CCTGCGTGTG