e.g. 1:1246..9423
SNP Detail For snp_cf0005000444171    [See in GBrowse]
1.General Information
SNP ID: snp_cf0005000444171
Organism: Canis familiaris
Individual: CHW
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: K
5'flank: TTTATTTTTCATCTCAGAAGAGACTGTGGT
3'flank: GGCTTGGGGCCAGGCACATTGCTGCACCTG
3.Reference Map information
Chrom Position Reference CHW
Chr11 397767 G K
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000028630 4239 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000044362 909 CCC => CCA ENSCAFP00000038351 303 P => P
- ENSCAFT00000049093 909 CCC => CCA ENSCAFP00000040764 303 P => P
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0051000364966 LJ6 K TTTATTTTTCATCTCAGAAGAGACTGTGGT GGCTTGGGGCCAGGCACATTGCTGCACCTG 2014-07-19 2014-07-19
snp_cf0062000373744 TM3 K TTTATTTTTCATCTCAGAAGAGACTGTGGT GGCTTGGGGCCAGGCACATTGCTGCACCTG 2014-07-19 2014-07-19
snp_cf0045000308804 LJ10 K TTTATTTTTCATCTCAGAAGAGACTGTGGT GGCTTGGGGCCAGGCACATTGCTGCACCTG 2014-07-19 2014-07-19
snp_cf0036000298400 KM1 K TTTATTTTTCATCTCAGAAGAGACTGTGGT GGCTTGGGGCCAGGCACATTGCTGCACCTG 2014-07-19 2014-07-19
snp_cf0075000382782 YJ6 K TTTATTTTTCATCTCAGAAGAGACTGTGGT GGCTTGGGGCCAGGCACATTGCTGCACCTG 2014-07-19 2014-07-19
snp_cf0073000381463 YJ4 K TTTATTTTTCATCTCAGAAGAGACTGTGGT GGCTTGGGGCCAGGCACATTGCTGCACCTG 2014-07-19 2014-07-19
6.Fasta Information
TTGAGGGAAA CATTCCAGAC TTTATTTTTC ATCTCAGAAG AGACTGTGGT
K
GGCTTGGGGC CAGGCACATT GCTGCACCTG CAGGACAAAG ACCCAGAGGA