e.g. 1:1246..9423
SNP Detail For snp_cf0005000444352    [See in GBrowse]
1.General Information
SNP ID: snp_cf0005000444352
Organism: Canis familiaris
Individual: CHW
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: TGAGACTTCATGATGGCCTTGTACTCCTCC
3'flank: TGGGTTTTCCCATACTTTGGGCCACCTCCT
3.Reference Map information
Chrom Position Reference CHW
Chr11 509880 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000028829 989 - T CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000020092 989 AAG => AGG ENSCAFP00000018634 330 K => R
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0057000457485 LUPWRUS00002 Y TGAGACTTCATGATGGCCTTGTACTCCTCC TGGGTTTTCCCATACTTTGGGCCACCTCCT 2014-07-19 2014-07-19
snp_cf0012000363296 DQ4 Y TGAGACTTCATGATGGCCTTGTACTCCTCC TGGGTTTTCCCATACTTTGGGCCACCTCCT 2014-07-19 2014-07-19
snp_cf0002000240183 CID1 Y TGAGACTTCATGATGGCCTTGTACTCCTCC TGGGTTTTCCCATACTTTGGGCCACCTCCT 2014-08-02 2014-08-02
snp_cf0045000308898 LJ10 Y TGAGACTTCATGATGGCCTTGTACTCCTCC TGGGTTTTCCCATACTTTGGGCCACCTCCT 2014-07-19 2014-07-19
snp_cf0034000448311 ISW Y TGAGACTTCATGATGGCCTTGTACTCCTCC TGGGTTTTCCCATACTTTGGGCCACCTCCT 2014-07-19 2014-07-19
snp_cf0073000381572 YJ4 Y TGAGACTTCATGATGGCCTTGTACTCCTCC TGGGTTTTCCCATACTTTGGGCCACCTCCT 2014-07-19 2014-07-19
snp_cf0075000382887 YJ6 Y TGAGACTTCATGATGGCCTTGTACTCCTCC TGGGTTTTCCCATACTTTGGGCCACCTCCT 2014-07-19 2014-07-19
snp_cf0058000470267 LUPWRUS00003 Y TGAGACTTCATGATGGCCTTGTACTCCTCC TGGGTTTTCCCATACTTTGGGCCACCTCCT 2014-07-19 2014-07-19
snp_cf0051000365061 LJ6 Y TGAGACTTCATGATGGCCTTGTACTCCTCC TGGGTTTTCCCATACTTTGGGCCACCTCCT 2014-07-19 2014-07-19
snp_cf0060000375892 TM1 Y TGAGACTTCATGATGGCCTTGTACTCCTCC TGGGTTTTCCCATACTTTGGGCCACCTCCT 2014-07-19 2014-07-19
snp_cf0062000373917 TM3 Y TGAGACTTCATGATGGCCTTGTACTCCTCC TGGGTTTTCCCATACTTTGGGCCACCTCCT 2014-07-19 2014-07-19
6.Fasta Information
CTAGGGCAGT GTGCAGATCC TGAGACTTCA TGATGGCCTT GTACTCCTCC
Y
TGGGTTTTCC CATACTTTGG GCCACCTCCT GGAGAGAGTC ATCATCCACA