e.g. 1:1246..9423
SNP Detail For snp_cf0005000444353    [See in GBrowse]
1.General Information
SNP ID: snp_cf0005000444353
Organism: Canis familiaris
Individual: CHW
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: GAATATGATGGGTTCACACACTCCCTCCTT
3'flank: TGGAGAGTTTCCCTGATATTCTCCCGGATA
3.Reference Map information
Chrom Position Reference CHW
Chr11 510209 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000028829 660 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000020092 660 CAC => CAT ENSCAFP00000018634 220 H => H
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0062000373918 TM3 R GAATATGATGGGTTCACACACTCCCTCCTT TGGAGAGTTTCCCTGATATTCTCCCGGATA 2014-07-19 2014-07-19
6.Fasta Information
GGGTTGAAGC TGGAGACCAG GAATATGATG GGTTCACACA CTCCCTCCTT
R
TGGAGAGTTT CCCTGATATT CTCCCGGATA TTCCGCAGGA GTTGTTCTTC