e.g. 1:1246..9423
SNP Detail For snp_cf0005000444441    [See in GBrowse]
1.General Information
SNP ID: snp_cf0005000444441
Organism: Canis familiaris
Individual: CHW
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: ATTTCATCCTTATTGAAATCACTGGGTTTA
3'flank: TTCTTTTTAGATTATATAAATCACTGTCCA
3.Reference Map information
Chrom Position Reference CHW
Chr11 572347 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000012657 584 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000020089 584 ACT => ATT ENSCAFP00000041944 195 T => I
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0062000374006 TM3 R ATTTCATCCTTATTGAAATCACTGGGTTTA TTCTTTTTAGATTATATAAATCACTGTCCA 2014-07-19 2014-07-19
6.Fasta Information
CATTACGGAT CTTTAGCAGG ATTTCATCCT TATTGAAATC ACTGGGTTTA
R
TTCTTTTTAG ATTATATAAA TCACTGTCCA CTTTAGATCG GACAAAGTAG