e.g. 1:1246..9423
SNP Detail For snp_cf0005000444969    [See in GBrowse]
1.General Information
SNP ID: snp_cf0005000444969
Organism: Canis familiaris
Individual: CHW
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: M
5'flank: TTTCTTCAAGATGGTTCTGGTGTCCTCAGC
3'flank: ACTATTTCCAGGAGGCGTCTGTGTTTCCAC
3.Reference Map information
Chrom Position Reference CHW
Chr11 922853 C M
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000497 35034 - C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000000781 1362 GTG => GTT ENSCAFP00000000720 454 V => V
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0062000374530 TM3 M TTTCTTCAAGATGGTTCTGGTGTCCTCAGC ACTATTTCCAGGAGGCGTCTGTGTTTCCAC 2014-07-19 2014-07-19
snp_cf0012000363807 DQ4 M TTTCTTCAAGATGGTTCTGGTGTCCTCAGC ACTATTTCCAGGAGGCGTCTGTGTTTCCAC 2014-07-19 2014-07-19
snp_cf0034000448791 ISW M TTTCTTCAAGATGGTTCTGGTGTCCTCAGC ACTATTTCCAGGAGGCGTCTGTGTTTCCAC 2014-07-19 2014-07-19
snp_cf0058000470768 LUPWRUS00003 M TTTCTTCAAGATGGTTCTGGTGTCCTCAGC ACTATTTCCAGGAGGCGTCTGTGTTTCCAC 2014-07-19 2014-07-19
snp_cf0060000376405 TM1 M TTTCTTCAAGATGGTTCTGGTGTCCTCAGC ACTATTTCCAGGAGGCGTCTGTGTTTCCAC 2014-07-19 2014-07-19
snp_cf0057000457898 LUPWRUS00002 M TTTCTTCAAGATGGTTCTGGTGTCCTCAGC ACTATTTCCAGGAGGCGTCTGTGTTTCCAC 2014-07-19 2014-07-19
6.Fasta Information
ATGATGGAGT CTTTCAGGAT TTTCTTCAAG ATGGTTCTGG TGTCCTCAGC
M
ACTATTTCCA GGAGGCGTCT GTGTTTCCAC TTTCTCAGAA AGTTGATAAT