e.g. 1:1246..9423
SNP Detail For snp_cf0005000444974    [See in GBrowse]
1.General Information
SNP ID: snp_cf0005000444974
Organism: Canis familiaris
Individual: CHW
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: TGTCTCCAGTGAGGATTTCATGCTAAGGTC
3'flank: GAGTGGAGCTCTGGGCAGGCCTCCCAGTAA
3.Reference Map information
Chrom Position Reference CHW
Chr11 926581 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000000497 31306 - C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000000781 168 TCG => TCA ENSCAFP00000000720 56 S => S
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0034000448796 ISW Y TGTCTCCAGTGAGGATTTCATGCTAAGGTC GAGTGGAGCTCTGGGCAGGCCTCCCAGTAA 2014-07-19 2014-07-19
snp_cf0062000374536 TM3 Y TGTCTCCAGTGAGGATTTCATGCTAAGGTC GAGTGGAGCTCTGGGCAGGCCTCCCAGTAA 2014-07-19 2014-07-19
snp_cf0058000470772 LUPWRUS00003 Y TGTCTCCAGTGAGGATTTCATGCTAAGGTC GAGTGGAGCTCTGGGCAGGCCTCCCAGTAA 2014-07-19 2014-07-19
snp_cf0060000376410 TM1 Y TGTCTCCAGTGAGGATTTCATGCTAAGGTC GAGTGGAGCTCTGGGCAGGCCTCCCAGTAA 2014-07-19 2014-07-19
snp_cf0012000363813 DQ4 Y TGTCTCCAGTGAGGATTTCATGCTAAGGTC GAGTGGAGCTCTGGGCAGGCCTCCCAGTAA 2014-07-19 2014-07-19
6.Fasta Information
GCTATGCTAC CTACCTCACA TGTCTCCAGT GAGGATTTCA TGCTAAGGTC
Y
GAGTGGAGCT CTGGGCAGGC CTCCCAGTAA CCTCTTGGTG AATCTTCTCT