e.g. 1:1246..9423
SNP Detail For snp_cf0005001873477    [See in GBrowse]
1.General Information
SNP ID: snp_cf0005001873477
Organism: Canis familiaris
Individual: CHW
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: GAGGGGCGAGCGGGGCCGCCCGCGGCCCGA
3'flank: GCCCCGGGGCTTGGAGCGAGCCCTTGCGGC
3.Reference Map information
Chrom Position Reference CHW
Chr2 3712192 C G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000028464 1015 + C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000045637 637 CGC => GGC ENSCAFP00000036982 213 R => G
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0055001934775 LUPWCHN00001 S GAGGGGCGAGCGGGGCCGCCCGCGGCCCGA GCCCCGGGGCTTGGAGCGAGCCCTTGCGGC 2014-07-19 2014-07-19
snp_cf0037001294928 KM2 G GAGGGGCGAGCGGGGCCGCCCGCGGCCCGA GCCCCGGGGCTTGGAGCGAGCCCTTGCGGC 2014-07-19 2014-07-19
snp_cf0062001561337 TM3 S GAGGGGCGAGCGGGGCCGCCCGCGGCCCGA GCCCCGGGGCTTGGAGCGAGCCCTTGCGGC 2014-07-19 2014-07-19
snp_cf0008001540630 DQ10 S GAGGGGCGAGCGGGGCCGCCCGCGGCCCGA GCCCCGGGGCTTGGAGCGAGCCCTTGCGGC 2014-07-19 2014-07-19
snp_cf0011001569976 DQ3 S GAGGGGCGAGCGGGGCCGCCCGCGGCCCGA GCCCCGGGGCTTGGAGCGAGCCCTTGCGGC 2014-07-19 2014-07-19
snp_cf0044001369735 KM9 G GAGGGGCGAGCGGGGCCGCCCGCGGCCCGA GCCCCGGGGCTTGGAGCGAGCCCTTGCGGC 2014-07-19 2014-07-19
snp_cf0020001537048 FAMBTIM00001 G GAGGGGCGAGCGGGGCCGCCCGCGGCCCGA GCCCCGGGGCTTGGAGCGAGCCCTTGCGGC 2014-07-19 2014-07-19
snp_cf0040001372203 KM5 S GAGGGGCGAGCGGGGCCGCCCGCGGCCCGA GCCCCGGGGCTTGGAGCGAGCCCTTGCGGC 2014-07-19 2014-07-19
snp_cf0061001572327 TM2 S GAGGGGCGAGCGGGGCCGCCCGCGGCCCGA GCCCCGGGGCTTGGAGCGAGCCCTTGCGGC 2014-07-19 2014-07-19
snp_cf0043001303774 KM8 S GAGGGGCGAGCGGGGCCGCCCGCGGCCCGA GCCCCGGGGCTTGGAGCGAGCCCTTGCGGC 2014-07-19 2014-07-19
snp_cf0024001237385 GS10 G GAGGGGCGAGCGGGGCCGCCCGCGGCCCGA GCCCCGGGGCTTGGAGCGAGCCCTTGCGGC 2014-07-19 2014-07-19
6.Fasta Information
GCCCGGGTTC CGCGTGCGGG GAGGGGCGAG CGGGGCCGCC CGCGGCCCGA
G
GCCCCGGGGC TTGGAGCGAG CCCTTGCGGC TTCCCTTTGT TCCCGGTCCC