e.g. 1:1246..9423
SNP Detail For snp_cf0005001873478    [See in GBrowse]
1.General Information
SNP ID: snp_cf0005001873478
Organism: Canis familiaris
Individual: CHW
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC
3'flank: TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG
3.Reference Map information
Chrom Position Reference CHW
Chr2 3712276 G T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000028464 1099 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000045637 721 GTA => TTA ENSCAFP00000036982 241 V => L
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0018001304421 FAMBBEM00001 T GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
snp_cf0010001530549 DQ2 K GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
snp_cf0061001572328 TM2 T GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
snp_cf0016001546802 DQ8 T GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
snp_cf0059001537757 TM10 K GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
snp_cf0074001567265 YJ5 T GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
snp_cf0044001369736 KM9 T GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
snp_cf0076001598157 YJ7 K GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
snp_cf0068001500629 TM9 K GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
snp_cf0009001546503 DQ1 K GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
snp_cf0070001637388 YJ1 K GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
snp_cf0072001591856 YJ3 K GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
snp_cf0015001546949 DQ7 T GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
snp_cf0012001543598 DQ4 T GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
snp_cf0008001540631 DQ10 K GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
snp_cf0049001557305 LJ4 K GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
snp_cf0014001517498 DQ6 T GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
snp_cf0062001561338 TM3 K GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
snp_cf0052001512851 LJ7 K GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
snp_cf0035001499719 KM10 K GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
snp_cf0060001529696 TM1 T GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
snp_cf0077001570288 YJ8 T GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
snp_cf0063001529164 TM4 T GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
snp_cf0078001581578 YJ9 T GGGGCCGCTCTCCCCCGAGCGGCCTGGAGC TAGTAGCGCGCTTCCCGCTTGCAGAAGTCG 2014-07-19 2014-07-19
6.Fasta Information
CCTTTGTTCC CGGTCCCGTC GGGGCCGCTC TCCCCCGAGC GGCCTGGAGC
T
TAGTAGCGCG CTTCCCGCTT GCAGAAGTCG GGCCGCAGCC TTCAGGGCCT