e.g. 1:1246..9423
SNP Detail For snp_cf0005001874535    [See in GBrowse]
1.General Information
SNP ID: snp_cf0005001874535
Organism: Canis familiaris
Individual: CHW
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: T
5'flank: GATAGCTCCTTTTGTAGTCCATTAATCTTA
3'flank: ATCCCATTTTTTTAATTCTTCTTATAAGTT
3.Reference Map information
Chrom Position Reference CHW
Chr2 6299967 C T
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000014021 123942 - C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000022255 1391 TGT => TAT ENSCAFP00000020668 464 C => Y
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0012001545504 DQ4 Y GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0018001305415 FAMBBEM00001 Y GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0056001960702 LUPWRUS00001 T GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0030001204057 GS6 Y GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0004001301271 Basenji T GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0044001370698 KM9 Y GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0035001500684 KM10 Y GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0019001187622 FAMBGSD00001 T GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0016001548726 DQ8 Y GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0041001560608 KM6 Y GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0054001387218 LJ9 Y GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0043001304628 KM8 Y GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0033001212930 GS9 Y GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0042001615442 KM7 Y GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0027001208324 GS3 T GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0049001558353 LJ4 Y GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0058001940019 LUPWRUS00003 Y GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0037001295569 KM2 Y GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0025001189715 GS1 Y GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0034001826307 ISW Y GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0036001211635 KM1 Y GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0040001372851 KM5 Y GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0024001238048 GS10 T GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0031001208974 GS7 T GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0026001185026 GS2 T GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0032001191931 GS8 Y GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0028001149516 GS4 T GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0073001536811 YJ4 Y GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0008001541810 DQ10 Y GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0055001936328 LUPWCHN00001 Y GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0057001861682 LUPWRUS00002 T GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
snp_cf0075001586322 YJ6 Y GATAGCTCCTTTTGTAGTCCATTAATCTTA ATCCCATTTTTTTAATTCTTCTTATAAGTT 2014-07-19 2014-07-19
6.Fasta Information
ATTTCATTTC TTTTGTTTCT GATAGCTCCT TTTGTAGTCC ATTAATCTTA
T
ATCCCATTTT TTTAATTCTT CTTATAAGTT GTTCACAGTC ATTTTTTTTA