e.g. 1:1246..9423
SNP Detail For snp_cf0005001874799    [See in GBrowse]
1.General Information
SNP ID: snp_cf0005001874799
Organism: Canis familiaris
Individual: CHW
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs22813774  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: CTTTCTCAAGGACTAATTTGTCCCATGTCT
3'flank: TAGATCACAGGGATACCACTCCTTATTCTA
3.Reference Map information
Chrom Position Reference CHW
Chr2 6846508 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000004382 16341 + G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
+ ENSCAFT00000007043 769 GTA => ATA ENSCAFP00000006520 257 V => I
+ ENSCAFT00000045083 763 GTA => ATA ENSCAFP00000038134 255 V => I
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0052001513916 LJ7 R CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0011001570890 DQ3 R CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0070001638261 YJ1 R CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0064001564822 TM5 R CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0040001373095 KM5 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0026001185280 GS2 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0071001582908 YJ2 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0036001211861 KM1 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0066001580576 TM7 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0009001547372 DQ1 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0076001598993 YJ7 R CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0007001331734 Dingo A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0075001586554 YJ6 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0048001472560 LJ3 R CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0013001472520 DQ5 R CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0046001439930 LJ1 R CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0018001305621 FAMBBEM00001 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0022001406198 FAMICHN00002 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0025001189957 GS1 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0047001503779 LJ2 R CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0004001301482 Basenji A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0033001213163 GS9 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0028001149763 GS4 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0061001573204 TM2 R CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0062001562485 TM3 R CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0041001560833 KM6 R CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0035001500821 KM10 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0069001601008 YJ10 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0023001445364 FAMICHN00003 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0027001208577 GS3 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0006001799568 CRW A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0019001187829 FAMBGSD00001 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0072001592741 YJ3 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0024001238290 GS10 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0032001192154 GS8 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0008001542041 DQ10 R CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0031001209217 GS7 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0074001568138 YJ5 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0016001548974 DQ8 R CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0030001204281 GS6 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0059001538571 TM10 R CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0060001530690 TM1 R CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0039001272991 KM4 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0038001215425 KM3 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0073001537054 YJ4 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0045001400211 LJ10 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0037001295823 KM2 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0050001442816 LJ5 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0042001615746 KM7 R CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0014001518186 DQ6 R CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0020001537839 FAMBTIM00001 R CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0051001542354 LJ6 R CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0029001131272 GS5 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0067001521423 TM8 R CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0077001570988 YJ8 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0003000875383 dbSNP139 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0002001022008 CID1 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-08-02 2014-08-02
snp_cf0054001387422 LJ9 R CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0078001582521 YJ9 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0044001370929 KM9 A CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
snp_cf0049001558562 LJ4 R CTTTCTCAAGGACTAATTTGTCCCATGTCT TAGATCACAGGGATACCACTCCTTATTCTA 2014-07-19 2014-07-19
6.Fasta Information
ATGTATTTGA AACATCACAG CTTTCTCAAG GACTAATTTG TCCCATGTCT
R
TAGATCACAG GGATACCACT CCTTATTCTA GCAAACTACT ACACTCATGT