e.g. 1:1246..9423
SNP Detail For snp_cf0050000000007    [See in GBrowse]
1.General Information
SNP ID: snp_cf0050000000007
Organism: Canis familiaris
Individual: LJ5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA
3'flank: AATGGAGACCTGGGCGGTATCTCCAGGTGC
3.Reference Map information
Chrom Position Reference LJ5
Chr1 9828 T C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0077000000005 YJ8 Y TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA AATGGAGACCTGGGCGGTATCTCCAGGTGC 2014-07-19 2014-07-19
snp_cf0016000000008 DQ8 Y TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA AATGGAGACCTGGGCGGTATCTCCAGGTGC 2014-07-19 2014-07-19
snp_cf0042000000004 KM7 Y TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA AATGGAGACCTGGGCGGTATCTCCAGGTGC 2014-07-19 2014-07-19
snp_cf0013000000001 DQ5 C TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA AATGGAGACCTGGGCGGTATCTCCAGGTGC 2014-07-19 2014-07-19
snp_cf0048000000001 LJ3 Y TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA AATGGAGACCTGGGCGGTATCTCCAGGTGC 2014-07-19 2014-07-19
snp_cf0076000000002 YJ7 Y TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA AATGGAGACCTGGGCGGTATCTCCAGGTGC 2014-07-19 2014-07-19
snp_cf0007000000004 Dingo Y TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA AATGGAGACCTGGGCGGTATCTCCAGGTGC 2014-07-19 2014-07-19
snp_cf0070000000004 YJ1 Y TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA AATGGAGACCTGGGCGGTATCTCCAGGTGC 2014-07-19 2014-07-19
snp_cf0068000000003 TM9 C TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA AATGGAGACCTGGGCGGTATCTCCAGGTGC 2014-07-19 2014-07-19
snp_cf0049000000005 LJ4 Y TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA AATGGAGACCTGGGCGGTATCTCCAGGTGC 2014-07-19 2014-07-19
snp_cf0008000000001 DQ10 C TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA AATGGAGACCTGGGCGGTATCTCCAGGTGC 2014-07-19 2014-07-19
snp_cf0027000000004 GS3 C TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA AATGGAGACCTGGGCGGTATCTCCAGGTGC 2014-07-19 2014-07-19
snp_cf0066000000005 TM7 Y TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA AATGGAGACCTGGGCGGTATCTCCAGGTGC 2014-07-19 2014-07-19
snp_cf0046000000005 LJ1 Y TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA AATGGAGACCTGGGCGGTATCTCCAGGTGC 2014-07-19 2014-07-19
snp_cf0056000000001 LUPWRUS00001 C TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA AATGGAGACCTGGGCGGTATCTCCAGGTGC 2014-07-19 2014-07-19
snp_cf0031000000004 GS7 C TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA AATGGAGACCTGGGCGGTATCTCCAGGTGC 2014-07-19 2014-07-19
snp_cf0014000000006 DQ6 Y TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA AATGGAGACCTGGGCGGTATCTCCAGGTGC 2014-07-19 2014-07-19
snp_cf0052000000002 LJ7 Y TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA AATGGAGACCTGGGCGGTATCTCCAGGTGC 2014-07-19 2014-07-19
snp_cf0009000000007 DQ1 Y TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA AATGGAGACCTGGGCGGTATCTCCAGGTGC 2014-07-19 2014-07-19
snp_cf0012000000001 DQ4 C TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA AATGGAGACCTGGGCGGTATCTCCAGGTGC 2014-07-19 2014-07-19
snp_cf0025000000002 GS1 Y TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA AATGGAGACCTGGGCGGTATCTCCAGGTGC 2014-07-19 2014-07-19
snp_cf0011000000007 DQ3 C TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA AATGGAGACCTGGGCGGTATCTCCAGGTGC 2014-07-19 2014-07-19
snp_cf0015000000006 DQ7 Y TTTGCCAGAGGCTTCTGAGTCGCAAGTTAA AATGGAGACCTGGGCGGTATCTCCAGGTGC 2014-07-19 2014-07-19
6.Fasta Information
GAACGTCTTC AGAAGAGACG TTTGCCAGAG GCTTCTGAGT CGCAAGTTAA
C
AATGGAGACC TGGGCGGTAT CTCCAGGTGC AGTAGAGTGG TAATCTTGGT