e.g. 1:1246..9423
SNP Detail For snp_cf0050000000009    [See in GBrowse]
1.General Information
SNP ID: snp_cf0050000000009
Organism: Canis familiaris
Individual: LJ5
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: W
5'flank: CAGGGCTAATTTATTTTATTTTATTTTTTT
3'flank: ATTTTTATTTATTTATGATAGTTACAGAGA
3.Reference Map information
Chrom Position Reference LJ5
Chr1 17530 T W
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0010000000005 DQ2 A CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0054000000002 LJ9 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0013000000002 DQ5 A CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0022000000003 FAMICHN00002 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0028000000001 GS4 A CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0074000000004 YJ5 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0057000000006 LUPWRUS00002 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0068000000004 TM9 A CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0039000000005 KM4 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0008000000003 DQ10 A CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0060000000005 TM1 A CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0024000000004 GS10 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0056000000004 LUPWRUS00001 A CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0027000000005 GS3 A CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0059000000003 TM10 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0021000000006 FAMICHN00001 A CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0033000000001 GS9 A CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0051000000009 LJ6 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0065000000001 TM6 A CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0016000000010 DQ8 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0047000000002 LJ2 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0012000000002 DQ4 A CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0015000000007 DQ7 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0062000000001 TM3 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0006000000004 CRW A CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0038000000002 KM3 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0035000000005 KM10 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0018000000002 FAMBBEM00001 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0049000000006 LJ4 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0058000000006 LUPWRUS00003 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0005000000008 CHW W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0072000000003 YJ3 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0066000000006 TM7 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0043000000002 KM8 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0069000000004 YJ10 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0031000000005 GS7 A CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0040000000005 KM5 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0078000000004 YJ9 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0020000000003 FAMBTIM00001 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0063000000001 TM4 A CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0052000000004 LJ7 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0025000000003 GS1 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0034000000005 ISW W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0075000000006 YJ6 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
snp_cf0011000000008 DQ3 W CAGGGCTAATTTATTTTATTTTATTTTTTT ATTTTTATTTATTTATGATAGTTACAGAGA 2014-07-19 2014-07-19
6.Fasta Information
ACCCAGTCCC CGCCAGTCTC CAGGGCTAAT TTATTTTATT TTATTTTTTT
W
ATTTTTATTT ATTTATGATA GTTACAGAGA GAGAGAGAGG CAGAGACACA