e.g. 1:1246..9423
SNP Detail For snp_cf0051000000005    [See in GBrowse]
1.General Information
SNP ID: snp_cf0051000000005
Organism: Canis familiaris
Individual: LJ6
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: GAAAAGCATGTGGAATCGTTGTTCCTGACC
3'flank: TACGTGTATCTGAGTTGAATACAGCGATTT
3.Reference Map information
Chrom Position Reference LJ6
Chr1 8618 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0009000000005 DQ1 Y GAAAAGCATGTGGAATCGTTGTTCCTGACC TACGTGTATCTGAGTTGAATACAGCGATTT 2014-07-19 2014-07-19
snp_cf0005000000005 CHW Y GAAAAGCATGTGGAATCGTTGTTCCTGACC TACGTGTATCTGAGTTGAATACAGCGATTT 2014-07-19 2014-07-19
snp_cf0016000000005 DQ8 Y GAAAAGCATGTGGAATCGTTGTTCCTGACC TACGTGTATCTGAGTTGAATACAGCGATTT 2014-07-19 2014-07-19
6.Fasta Information
GTGGCTGGGA GAGGTTTTGA GAAAAGCATG TGGAATCGTT GTTCCTGACC
Y
TACGTGTATC TGAGTTGAAT ACAGCGATTT CCAAAGACCT TCTTCAATCA