e.g. 1:1246..9423
SNP Detail For snp_cf0051000000008    [See in GBrowse]
1.General Information
SNP ID: snp_cf0051000000008
Organism: Canis familiaris
Individual: LJ6
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: M
5'flank: CAGTTCCACACTGCCTGCAGAGTGAGTTCA
3'flank: ACGTCTTCACCAGAGACGTTTGCCAGAGTT
3.Reference Map information
Chrom Position Reference LJ6
Chr1 10512 C M
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0077000000006 YJ8 A CAGTTCCACACTGCCTGCAGAGTGAGTTCA ACGTCTTCACCAGAGACGTTTGCCAGAGTT 2014-07-19 2014-07-19
snp_cf0046000000006 LJ1 M CAGTTCCACACTGCCTGCAGAGTGAGTTCA ACGTCTTCACCAGAGACGTTTGCCAGAGTT 2014-07-19 2014-07-19
snp_cf0009000000008 DQ1 M CAGTTCCACACTGCCTGCAGAGTGAGTTCA ACGTCTTCACCAGAGACGTTTGCCAGAGTT 2014-07-19 2014-07-19
snp_cf0023000000005 FAMICHN00003 M CAGTTCCACACTGCCTGCAGAGTGAGTTCA ACGTCTTCACCAGAGACGTTTGCCAGAGTT 2014-07-19 2014-07-19
snp_cf0075000000005 YJ6 M CAGTTCCACACTGCCTGCAGAGTGAGTTCA ACGTCTTCACCAGAGACGTTTGCCAGAGTT 2014-07-19 2014-07-19
snp_cf0050000000008 LJ5 A CAGTTCCACACTGCCTGCAGAGTGAGTTCA ACGTCTTCACCAGAGACGTTTGCCAGAGTT 2014-07-19 2014-07-19
snp_cf0002000000038 CID1 M CAGTTCCACACTGCCTGCAGAGTGAGTTCA ACGTCTTCACCAGAGACGTTTGCCAGAGTT 2014-08-02 2014-08-02
6.Fasta Information
AGCCCACCCT CAGTCCCTCA CAGTTCCACA CTGCCTGCAG AGTGAGTTCA
M
ACGTCTTCAC CAGAGACGTT TGCCAGAGTT TTTTGAGACT CAAGTGGAAC