e.g. 1:1246..9423
SNP Detail For snp_cf0027000000090    [See in GBrowse]
1.General Information
SNP ID: snp_cf0027000000090
Organism: Canis familiaris
Individual: LJ9
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: K
5'flank: GGGGCTCTTGTGAAGGGGCACTGTACCATG
3'flank: GATGAACTTCTTTGGGGTTCTTTGGGGTGT
3.Reference Map information
Chrom Position Reference GS3
Chr1 266523 G K
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0060000000060 TM1 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0016000000069 DQ8 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0042000000104 KM7 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0045000000066 LJ10 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0010000000069 DQ2 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0017000000059 DQ9 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0061000000070 TM2 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0078000000077 YJ9 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0043000000178 KM8 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0036000000072 KM1 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0040000000092 KM5 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0071000000065 YJ2 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0067000000063 TM8 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0063000000075 TM4 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0012000000067 DQ4 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0035000000080 KM10 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0009000000066 DQ1 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0041000000088 KM6 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0032000000086 GS8 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0023000000068 FAMICHN00003 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0037000000073 KM2 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0068000000056 TM9 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0018000000163 FAMBBEM00001 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0059000000064 TM10 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0004000000059 Basenji T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0046000000067 LJ1 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0075000000065 YJ6 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0019000000081 FAMBGSD00001 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0049000000074 LJ4 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0052000000067 LJ7 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0064000000071 TM5 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0053000000075 LJ8 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0038000000072 KM3 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0013000000060 DQ5 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0062000000056 TM3 T GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0044000000074 KM9 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0025000000088 GS1 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
snp_cf0039000000081 KM4 K GGGGCTCTTGTGAAGGGGCACTGTACCATG GATGAACTTCTTTGGGGTTCTTTGGGGTGT 2014-07-19 2014-07-19
6.Fasta Information
AGCAGTCAAG GTTATGTCTG GGGGCTCTTG TGAAGGGGCA CTGTACCATG
K
GATGAACTTC TTTGGGGTTC TTTGGGGTGT AGACAGGATT CTTTAGAAGG