e.g. 1:1246..9423
SNP Detail For snp_cf0027000000239    [See in GBrowse]
1.General Information
SNP ID: snp_cf0027000000239
Organism: Canis familiaris
Individual: LJ9
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs21953191  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: GTTTTGGAGCAATGTGCATTTGCTTCAAAA
3'flank: TCCAGGTTTCTTAATATGTTCTGAAATCAC
3.Reference Map information
Chrom Position Reference GS3
Chr1 604894 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0035000000215 KM10 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0061000000197 TM2 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0023000000176 FAMICHN00003 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0014000000186 DQ6 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0055000000275 LUPWCHN00001 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0018000000469 FAMBBEM00001 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0078000000214 YJ9 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0017000000182 DQ9 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0025000000237 GS1 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0028000000159 GS4 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0066000000173 TM7 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0072000000173 YJ3 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0043000000511 KM8 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0034000000432 ISW G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0022000000198 FAMICHN00002 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0064000000206 TM5 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0013000000176 DQ5 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0069000000174 YJ10 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0041000000247 KM6 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0046000000170 LJ1 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0059000000182 TM10 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0011000000172 DQ3 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0005000000175 CHW G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0037000000195 KM2 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0068000000158 TM9 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0004000000162 Basenji G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0008000000104 DQ10 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0053000000213 LJ8 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0049000000194 LJ4 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0071000000174 YJ2 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0065000000499 TM6 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0012000000176 DQ4 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0048000000180 LJ3 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0030000000213 GS6 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0040000000241 KM5 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0051000000120 LJ6 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0006000000177 CRW G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0019000000226 FAMBGSD00001 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0032000000231 GS8 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0016000000189 DQ8 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0054000000164 LJ9 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0045000000165 LJ10 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0036000000205 KM1 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0042000000281 KM7 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0060000000169 TM1 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0026000000162 GS2 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0056000000463 LUPWRUS00001 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0024000000167 GS10 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0075000000193 YJ6 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0077000000193 YJ8 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0052000000179 LJ7 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0067000000182 TM8 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0063000000196 TM4 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0044000000188 KM9 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0050000000181 LJ5 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0029000000164 GS5 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0076000000182 YJ7 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0057000000175 LUPWRUS00002 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0070000000183 YJ1 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0058000000307 LUPWRUS00003 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0074000000212 YJ5 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0038000000204 KM3 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0021000000181 FAMICHN00001 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0003000000407 dbSNP139 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0039000000217 KM4 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0073000000200 YJ4 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0010000000177 DQ2 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0009000000182 DQ1 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0001000000274 solidGW1 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-08-01 2014-08-01
snp_cf0047000000118 LJ2 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0033000000210 GS9 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0007000000166 Dingo G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0020000000200 FAMBTIM00001 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0031000000169 GS7 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0062000000171 TM3 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
snp_cf0002000000242 CID1 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-08-02 2014-08-02
snp_cf0015000000214 DQ7 G GTTTTGGAGCAATGTGCATTTGCTTCAAAA TCCAGGTTTCTTAATATGTTCTGAAATCAC 2014-07-19 2014-07-19
6.Fasta Information
TGCAGCCAAA GGCGCTGCTG GTTTTGGAGC AATGTGCATT TGCTTCAAAA
G
TCCAGGTTTC TTAATATGTT CTGAAATCAC GGACCTAAGT TTATTCTCCA