e.g. 1:1246..9423
SNP Detail For snp_cf0027000000313    [See in GBrowse]
1.General Information
SNP ID: snp_cf0027000000313
Organism: Canis familiaris
Individual: LJ9
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs21944866  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: GAGAAGTGAGTTATTTAAAGCCTTACCTCC
3'flank: CCAGAGCCAAACTGCCTCTGTCCTGAATGA
3.Reference Map information
Chrom Position Reference GS3
Chr1 699873 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0015000000271 DQ7 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0073000000274 YJ4 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0068000000209 TM9 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0009000000234 DQ1 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0060000000220 TM1 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0072000000218 YJ3 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0067000000237 TM8 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0007000000208 Dingo A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0046000000230 LJ1 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0020000000255 FAMBTIM00001 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0040000000315 KM5 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0012000000224 DQ4 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0019000000295 FAMBGSD00001 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0025000000313 GS1 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0061000000268 TM2 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0016000000238 DQ8 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0003000000463 dbSNP139 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0074000000277 YJ5 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0039000000279 KM4 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0032000000306 GS8 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0054000000219 LJ9 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0042000000370 KM7 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0049000000267 LJ4 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0056000000551 LUPWRUS00001 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0043000000582 KM8 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0037000000266 KM2 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0044000000234 KM9 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0038000000276 KM3 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0076000000251 YJ7 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0035000000274 KM10 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0010000000228 DQ2 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0077000000264 YJ8 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0070000000254 YJ1 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0004000000222 Basenji R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0013000000228 DQ5 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0045000000203 LJ10 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0011000000232 DQ3 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0033000000284 GS9 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0065000000582 TM6 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0030000000286 GS6 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0041000000319 KM6 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0053000000267 LJ8 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0014000000234 DQ6 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0078000000277 YJ9 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0034000000496 ISW R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0002000000277 CID1 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-08-02 2014-08-02
snp_cf0071000000221 YJ2 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0062000000222 TM3 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0018000000529 FAMBBEM00001 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0022000000250 FAMICHN00002 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0023000000225 FAMICHN00003 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0036000000278 KM1 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0064000000266 TM5 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0075000000265 YJ6 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0017000000232 DQ9 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0059000000232 TM10 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0063000000261 TM4 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0052000000226 LJ7 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0066000000245 TM7 R GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0069000000226 YJ10 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
snp_cf0047000000158 LJ2 A GAGAAGTGAGTTATTTAAAGCCTTACCTCC CCAGAGCCAAACTGCCTCTGTCCTGAATGA 2014-07-19 2014-07-19
6.Fasta Information
CCTGTAGTAA GCTCCTGTCA GAGAAGTGAG TTATTTAAAG CCTTACCTCC
R
CCAGAGCCAA ACTGCCTCTG TCCTGAATGA ACACTATTGG CGGCACGTTC