e.g. 1:1246..9423
SNP Detail For snp_cf0027000001266    [See in GBrowse]
1.General Information
SNP ID: snp_cf0027000001266
Organism: Canis familiaris
Individual: LJ9
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: GAGCACGAATGTGCACCTCACCTGCAAAAT
3'flank: TCCTGGTTGATGCCCACCGTGATGCTGAGC
3.Reference Map information
Chrom Position Reference GS3
Chr1 3030267 A G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0010000001537 DQ2 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0044000002198 KM9 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0074000002308 YJ5 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0077000001779 YJ8 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0042000002645 KM7 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0005000003653 CHW G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0024000001085 GS10 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0036000001512 KM1 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0032000001265 GS8 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0035000001626 KM10 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0066000002759 TM7 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0021000001558 FAMICHN00001 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0043000002134 KM8 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0023000001591 FAMICHN00003 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0026000001075 GS2 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0072000001941 YJ3 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0018000001996 FAMBBEM00001 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0065000002306 TM6 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0050000001572 LJ5 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0067000002142 TM8 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0029000001078 GS5 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0016000001145 DQ8 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0015000002208 DQ7 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0031000001084 GS7 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0073000002320 YJ4 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0061000001799 TM2 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0022000001643 FAMICHN00002 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0076000001652 YJ7 R GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0009000001250 DQ1 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0017000002106 DQ9 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0008000002257 DQ10 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0053000002239 LJ8 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0078000002127 YJ9 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0059000001668 TM10 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0045000000919 LJ10 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0019000001232 FAMBGSD00001 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0047000000777 LJ2 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0011000001977 DQ3 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0033000001409 GS9 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0064000002511 TM5 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0054000001498 LJ9 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0028000001073 GS4 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0014000002180 DQ6 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0060000001052 TM1 R GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0037000001671 KM2 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0058000003962 LUPWRUS00003 R GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0039000001899 KM4 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0002000001725 CID1 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-08-02 2014-08-02
snp_cf0063000001769 TM4 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0068000001043 TM9 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0020000002259 FAMBTIM00001 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0052000001664 LJ7 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0069000002178 YJ10 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0062000001559 TM3 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0038000002062 KM3 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0030000001413 GS6 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0025000001265 GS1 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0071000001525 YJ2 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0048000001567 LJ3 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0070000002168 YJ1 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0007000001928 Dingo G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0051000002194 LJ6 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0013000001246 DQ5 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0004000001267 Basenji G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0075000002090 YJ6 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0041000002408 KM6 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0012000001525 DQ4 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0046000001715 LJ1 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0049000002191 LJ4 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
snp_cf0040000001270 KM5 G GAGCACGAATGTGCACCTCACCTGCAAAAT TCCTGGTTGATGCCCACCGTGATGCTGAGC 2014-07-19 2014-07-19
6.Fasta Information
TCTCGGACAA GCACGGACAA GAGCACGAAT GTGCACCTCA CCTGCAAAAT
G
TCCTGGTTGA TGCCCACCGT GATGCTGAGC TGCTGGCCGG GCTGCGGGGG