e.g. 1:1246..9423
SNP Detail For snp_cf0027000001425    [See in GBrowse]
1.General Information
SNP ID: snp_cf0027000001425
Organism: Canis familiaris
Individual: LJ9
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: CGTAGGATGGCTGCATCTGCACGCTCTGCA
3'flank: GGCCGGCAGCGGCTTCACGGCACCGGGCAG
3.Reference Map information
Chrom Position Reference GS3
Chr1 4227658 T Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0076000002298 YJ7 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0071000001736 YJ2 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0032000001427 GS8 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0044000002433 KM9 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0022000002265 FAMICHN00002 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0009000001441 DQ1 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0016000001413 DQ8 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0011000003373 DQ3 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0055000005488 LUPWCHN00001 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0066000003409 TM7 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0069000002639 YJ10 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0001000003910 solidGW1 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-08-01 2014-08-01
snp_cf0078000002311 YJ9 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0059000001935 TM10 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0015000002724 DQ7 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0070000002543 YJ1 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0042000003602 KM7 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0074000002610 YJ5 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0017000002988 DQ9 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0005000005183 CHW C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0012000001706 DQ4 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0063000001971 TM4 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0019000001394 FAMBGSD00001 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0033000001605 GS9 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0052000001854 LJ7 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0013000001437 DQ5 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0028000001198 GS4 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0061000001984 TM2 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0029000001207 GS5 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0073000003761 YJ4 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0065000002927 TM6 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0057000005412 LUPWRUS00002 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0035000002179 KM10 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0067000003046 TM8 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0018000002632 FAMBBEM00001 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0060000001210 TM1 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0026000001204 GS2 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0038000002819 KM3 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0041000003503 KM6 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0021000001733 FAMICHN00001 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0058000005871 LUPWRUS00003 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0039000002473 KM4 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0024000001214 GS10 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0025000001427 GS1 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0072000002250 YJ3 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0006000005154 CRW Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0056000005159 LUPWRUS00001 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0010000001717 DQ2 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0030000001608 GS6 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0062000001747 TM3 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0064000002763 TM5 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0077000002257 YJ8 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0049000002466 LJ4 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0068000001197 TM9 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0008000002427 DQ10 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0031000001215 GS7 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0014000002745 DQ6 C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0040000001430 KM5 Y CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
snp_cf0034000005599 ISW C CGTAGGATGGCTGCATCTGCACGCTCTGCA GGCCGGCAGCGGCTTCACGGCACCGGGCAG 2014-07-19 2014-07-19
6.Fasta Information
CAGCGGCTTC ACGCCGCCCG CGTAGGATGG CTGCATCTGC ACGCTCTGCA
Y
GGCCGGCAGC GGCTTCACGG CACCGGGCAG CTGGTAGGCC GCGTGGATGC