e.g. 1:1246..9423
SNP Detail For snp_cf0027000001426    [See in GBrowse]
1.General Information
SNP ID: snp_cf0027000001426
Organism: Canis familiaris
Individual: LJ9
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: R
5'flank: CACGCTCTGCATGGCCGGCAGCGGCTTCAC
3'flank: GCACCGGGCAGCTGGTAGGCCGCGTGGATG
3.Reference Map information
Chrom Position Reference GS3
Chr1 4227677 G R
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
NA NA NA NA NA
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
NA NA NA NA NA NA NA
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0029000001208 GS5 A CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
snp_cf0028000001199 GS4 A CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
snp_cf0073000003762 YJ4 R CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
snp_cf0032000001428 GS8 R CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
snp_cf0041000003504 KM6 R CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
snp_cf0055000005489 LUPWCHN00001 R CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
snp_cf0026000001205 GS2 A CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
snp_cf0024000001215 GS10 A CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
snp_cf0021000001734 FAMICHN00001 R CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
snp_cf0025000001428 GS1 R CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
snp_cf0039000002474 KM4 R CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
snp_cf0001000003911 solidGW1 R CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-08-01 2014-08-01
snp_cf0035000002180 KM10 R CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
snp_cf0034000005600 ISW R CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
snp_cf0030000001609 GS6 R CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
snp_cf0038000002820 KM3 R CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
snp_cf0074000002611 YJ5 R CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
snp_cf0042000003603 KM7 R CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
snp_cf0004000001522 Basenji R CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
snp_cf0040000001431 KM5 R CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
snp_cf0031000001216 GS7 A CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
snp_cf0014000002746 DQ6 R CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
snp_cf0019000001395 FAMBGSD00001 R CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
snp_cf0052000001855 LJ7 R CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
snp_cf0033000001606 GS9 R CACGCTCTGCATGGCCGGCAGCGGCTTCAC GCACCGGGCAGCTGGTAGGCCGCGTGGATG 2014-07-19 2014-07-19
6.Fasta Information
GCGTAGGATG GCTGCATCTG CACGCTCTGC ATGGCCGGCA GCGGCTTCAC
R
GCACCGGGCA GCTGGTAGGC CGCGTGGATG CTGGGGTAGC CGCCCCACGA