e.g. 1:1246..9423
SNP Detail For snp_cf0006000920133    [See in GBrowse]
1.General Information
SNP ID: snp_cf0006000920133
Organism: Canis familiaris
Individual: CRW
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: Y
5'flank: AGAGTCCAGAGAATGTGTGGATTAGGGATC
3'flank: ACTGCCCACATTGTAGAAAGAGACTCTGCC
3.Reference Map information
Chrom Position Reference CRW
Chr14 467497 C Y
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000024874 8527 - C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000001758 1366 GGA => AGA ENSCAFP00000001618 456 G => R
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
NA NA NA NA NA NA NA
6.Fasta Information
CCTCAGAGGC ACTGAGAAGG AGAGTCCAGA GAATGTGTGG ATTAGGGATC
Y
ACTGCCCACA TTGTAGAAAG AGACTCTGCC AGCATCACAG TCCAGAAGAG