e.g. 1:1246..9423
SNP Detail For snp_cf0006000920343    [See in GBrowse]
1.General Information
SNP ID: snp_cf0006000920343
Organism: Canis familiaris
Individual: CRW
Create time: 2014-07-19
Last update: 2014-07-19
NCBI rs link rs22360895  
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: K
5'flank: ACACCTCAAGGCACTTACCTGTGACATCCA
3'flank: GCGGAAGGACACCTTCTGGCCCCCGGCCTC
3.Reference Map information
Chrom Position Reference CRW
Chr14 751163 G K
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000001161 28223 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000001792 3184 CTG => ATG ENSCAFP00000001649 1062 L => M
- ENSCAFT00000050108 3730 CTG => ATG ENSCAFP00000035951 1244 L => M
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0050000736496 LJ5 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0039000620558 KM4 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0061000811981 TM2 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0067000778378 TM8 T ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0056001015658 LUPWRUS00001 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0029000562912 GS5 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0048000760718 LJ3 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0034000944682 ISW T ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0030000644150 GS6 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0003000440360 dbSNP139 T ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0005000991588 CHW K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0042000805306 KM7 T ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0054000721305 LJ9 T ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0008000785924 DQ10 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0044000713088 KM9 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0012000803465 DQ4 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0026000611240 GS2 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0041000778188 KM6 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0028000594168 GS4 T ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0071000817809 YJ2 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0051000800889 LJ6 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0023000755346 FAMICHN00003 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0014000788754 DQ6 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0020000792732 FAMBTIM00001 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0066000815463 TM7 T ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0037000660399 KM2 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0019000621093 FAMBGSD00001 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0025000604194 GS1 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0036000635586 KM1 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0052000777338 LJ7 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0069000824272 YJ10 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0078000816157 YJ9 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0060000804574 TM1 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0055001004298 LUPWCHN00001 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0010000800602 DQ2 T ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0015000803132 DQ7 T ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0017000815485 DQ9 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0031000640122 GS7 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0065000780471 TM6 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0024000649990 GS10 T ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0013000773679 DQ5 T ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
snp_cf0009000802767 DQ1 K ACACCTCAAGGCACTTACCTGTGACATCCA GCGGAAGGACACCTTCTGGCCCCCGGCCTC 2014-07-19 2014-07-19
6.Fasta Information
AACTACCCTA AGGAGAAGAA ACACCTCAAG GCACTTACCT GTGACATCCA
K
GCGGAAGGAC ACCTTCTGGC CCCCGGCCTC GCAGCTGTAC TCCCCAGCGT