e.g. 1:1246..9423
SNP Detail For snp_cf0006000920365    [See in GBrowse]
1.General Information
SNP ID: snp_cf0006000920365
Organism: Canis familiaris
Individual: CRW
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: C
5'flank: AGCCGACTCCTTCTCCTGCACCTGCAGGTC
3'flank: TGCAGTCGTTTCTTGAAGGGCATGGTGCGC
3.Reference Map information
Chrom Position Reference CRW
Chr14 777496 G C
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000001161 1890 - G CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000001792 1014 CAC => CAG ENSCAFP00000001649 338 H => Q
- ENSCAFT00000050108 1014 CAC => CAG ENSCAFP00000035951 338 H => Q
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0067000778394 TM8 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0019000621106 FAMBGSD00001 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0037000660420 KM2 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0056001015678 LUPWRUS00001 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0030000644166 GS6 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0001000349936 solidGW1 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-08-01 2014-08-01
snp_cf0074000811919 YJ5 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0017000815499 DQ9 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0012000803482 DQ4 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0005000991603 CHW C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0077000818314 YJ8 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0033000619412 GS9 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0010000800618 DQ2 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0031000640137 GS7 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0041000778206 KM6 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0044000713102 KM9 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0051000800906 LJ6 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0071000817827 YJ2 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0008000785942 DQ10 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0070000841745 YJ1 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0011000807352 DQ3 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0035000778163 KM10 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0014000788771 DQ6 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0049000806127 LJ4 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0004000659704 Basenji C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0063000791187 TM4 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0043000656746 KM8 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0018000669884 FAMBBEM00001 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0062000804469 TM3 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0072000824202 YJ3 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0076000821560 YJ7 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0032000614488 GS8 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0020000792744 FAMBTIM00001 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0026000611253 GS2 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0058001005047 LUPWRUS00003 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0040000706054 KM5 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0027000621391 GS3 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0055001004309 LUPWCHN00001 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0073000814269 YJ4 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0015000803148 DQ7 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0066000815480 TM7 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0061000812002 TM2 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0068000770478 TM9 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0057000983616 LUPWRUS00002 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0021000761885 FAMICHN00001 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0036000635600 KM1 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0038000633426 KM3 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0059000811945 TM10 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0052000777355 LJ7 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0064000809555 TM5 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0042000805325 KM7 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0029000562926 GS5 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0069000824294 YJ10 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0009000802784 DQ1 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0060000804591 TM1 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0016000795966 DQ8 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0065000780490 TM6 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0024000649993 GS10 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0075000825935 YJ6 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0039000620572 KM4 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0053000777605 LJ8 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0028000594171 GS4 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0013000773695 DQ5 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0078000816175 YJ9 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
snp_cf0025000604209 GS1 C AGCCGACTCCTTCTCCTGCACCTGCAGGTC TGCAGTCGTTTCTTGAAGGGCATGGTGCGC 2014-07-19 2014-07-19
6.Fasta Information
GGCACCTCGC ACTGGAACGT AGCCGACTCC TTCTCCTGCA CCTGCAGGTC
C
TGCAGTCGTT TCTTGAAGGG CATGGTGCGC TCTATGGGGA GAGCGGGGGA