e.g. 1:1246..9423
SNP Detail For snp_cf0006000920367    [See in GBrowse]
1.General Information
SNP ID: snp_cf0006000920367
Organism: Canis familiaris
Individual: CRW
Create time: 2014-07-19
Last update: 2014-07-19
2.Allele Information
Platform: SOLEXA
Method: sequence
SNP Class: snp
Genotype: G
5'flank: TCGTGCAGTCGTTTCTTGAAGGGCATGGTG
3'flank: GCTCTATGGGGAGAGCGGGGGAGCGCTCTT
3.Reference Map information
Chrom Position Reference CRW
Chr14 777524 C G
4.Gene information
Gene model(s)
Gene ID Position in Gene Strands Gene Allele Location
ENSCAFG00000001161 1862 - C CDS
Transcript Protein
SNP to transcript Accession Position in Transcript Allele change Accession Position in Protein Residue change
- ENSCAFT00000001792 986 CGC => CCC ENSCAFP00000001649 329 R => P
- ENSCAFT00000050108 986 CGC => CCC ENSCAFP00000035951 329 R => P
5.SNPs of other individuals in this position
SNP_ID Individual Genotype 5' Near Seq 30 bp 3' Near Seq 30 bp Create time Last update time
snp_cf0001000349938 solidGW1 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-08-01 2014-08-01
snp_cf0019000621108 FAMBGSD00001 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0067000778396 TM8 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0037000660422 KM2 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0030000644168 GS6 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0056001015680 LUPWRUS00001 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0012000803484 DQ4 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0041000778208 KM6 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0042000805327 KM7 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0036000635602 KM1 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0008000785944 DQ10 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0031000640139 GS7 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0005000991605 CHW G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0033000619414 GS9 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0077000818316 YJ8 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0044000713104 KM9 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0049000806129 LJ4 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0071000817829 YJ2 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0035000778165 KM10 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0062000804471 TM3 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0070000841747 YJ1 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0011000807354 DQ3 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0014000788773 DQ6 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0010000800620 DQ2 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0058001005049 LUPWRUS00003 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0043000656748 KM8 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0018000669886 FAMBBEM00001 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0004000659706 Basenji G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0063000791189 TM4 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0072000824204 YJ3 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0076000821562 YJ7 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0051000800908 LJ6 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0073000814271 YJ4 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0020000792746 FAMBTIM00001 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0026000611255 GS2 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0040000706056 KM5 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0027000621393 GS3 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0061000812004 TM2 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0032000614490 GS8 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0074000811921 YJ5 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0057000983618 LUPWRUS00002 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0025000604211 GS1 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0066000815482 TM7 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0064000809557 TM5 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0021000761887 FAMICHN00001 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0029000562928 GS5 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0069000824296 YJ10 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0038000633428 KM3 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0059000811947 TM10 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0052000777357 LJ7 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0016000795968 DQ8 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0015000803150 DQ7 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0017000815501 DQ9 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0065000780492 TM6 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0009000802786 DQ1 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0060000804593 TM1 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0039000620574 KM4 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0075000825937 YJ6 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0078000816177 YJ9 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0028000594173 GS4 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0068000770480 TM9 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
snp_cf0013000773697 DQ5 G TCGTGCAGTCGTTTCTTGAAGGGCATGGTG GCTCTATGGGGAGAGCGGGGGAGCGCTCTT 2014-07-19 2014-07-19
6.Fasta Information
CCTTCTCCTG CACCTGCAGG TCGTGCAGTC GTTTCTTGAA GGGCATGGTG
G
GCTCTATGGG GAGAGCGGGG GAGCGCTCTT GAGGCGGGGA GGGACGGGGA